Skip to Content
Merck
All Photos(1)

Key Documents

EHU005681

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATGAACTCGGCCATTCTCTTGGACTCTCCCATTCTACTGATATCGGGGCTTTGATGTACCCTAGCTACACCTTCAGTGGTGATGTTCAGCTAGCTCAGGATGACATTGATGGCATCCAAGCCATATATGGACGTTCCCAAAATCCTGTCCAGCCCATCGGCCCACAAACCCCAAAAGCGTGTGACAGTAAGCTAACCTTTGATGCTATAACTACGATTCGGGGAGAAGTGATGTTCTTTAAAGACAGATTCTACATGCGCACAAATCCCTTCTACCCGGAAGTTGAGCTCAATTTCATTTCTGTTTTCTGGCCACAACTGCCAAATGGGCTTGAAGCTGCTTACGAATTTGCCGACAGAGATGAAGTCCGGTTTTTCAAAGGGAATAAGTACTGGGCTGTTCAGGGACAGAATGTGCTACACGGATACCCCAAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shuichi Shimada et al.
Journal of dermatological science, 100(3), 183-191 (2020-10-16)
Systemic sclerosis (SSc) is characterized by excessive deposition of collagen in the skin and internal organs. Recent studies have shown that chemokine (C-X-C motif) ligands (CXCLs) are involved in the pathogenesis of SSc. Our aim was to examine the anti-fibrotic
Ching-Ju Shen et al.
PloS one, 12(3), e0174487-e0174487 (2017-03-24)
High matrix metalloproteinase 1 (MMP1) expression is associated with enhanced breast cancer growth and metastasis and also might predict poor prognosis. In this study, we further investigated the functional role of MMP1 and how it is upregulated in multi-drug resistant
Elisa Roztocil et al.
Scientific reports, 10(1), 8477-8477 (2020-05-23)
Thyroid eye disease (TED) affects 25-50% of patients with Graves' Disease. In TED, collagen accumulation leads to an expansion of the extracellular matrix (ECM) which causes destructive tissue remodeling. The purpose of this study was to investigate the therapeutic potential
Rania Harati et al.
PloS one, 15(10), e0239292-e0239292 (2020-10-02)
Brain metastasis (BM) is a major cause of morbidity and mortality in breast cancer (BC) and its molecular mechanism remains poorly understood. Transmigration of metastatic cells through the brain endothelium is an essential step in BM. Metalloproteinase-1 (MMP-1) overexpression plays

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service