Skip to Content
Merck
All Photos(1)

Key Documents

EHU002941

Sigma-Aldrich

MISSION® esiRNA

targeting human SPARC

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGGGTACCTCTCCCACACCGAGCTGGCTCCACTGCGTGCTCCCCTCATCCCCATGGAGCATTGCACCACCCGCTTTTTCGAGACCTGTGACCTGGACAATGACAAGTACATCGCCCTGGATGAGTGGGCCGGCTGCTTCGGCATCAAGCAGAAGGATATCGACAAGGATCTTGTGATCTAAATCCACTCCTTCCACAGTACCGGATTCTCTCTTTAACCCTCCCCTTCGTGTTTCCCCCAATGTTTAAAATGTTTGGATGGTTTGTTGTTCTGCCTGGAGACAAGGTGCTAACATAGATTTAAGTGAATACATTAACGGTGCTAAAAATGAAAATTCTAACCCAAGACATGACATTCTTAGCTGTAACTTAACTATTAAGGCCTTTTCCACACGCATTAATAGTCCCATTTTTCTCTTGCCATTTGTAGCTTTGCCCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jijun Fu et al.
Carcinogenesis, 38(6), 649-660 (2017-05-13)
Oncogene c-Myc is frequently amplified and activated in human cancers. Deregulation of c-Myc protein has been shown to occur in 30% of all human cancers, especially in hematopoietic malignancies. As a transcription factor, c-Myc has been shown to regulate up
Jing Zhu et al.
Stem cells (Dayton, Ohio), 38(1), 134-145 (2019-10-24)
The purpose of this study was to investigate the effects of secreted protein acidic and rich in cysteine (SPARC) on the maintenance of limbal epithelial stem cell (LESC) stemness and restoration of ocular surface. To determine the suitable concentration of
Katrina Viloria et al.
Scientific reports, 6, 37839-37839 (2016-11-26)
SPARC is a matricellular protein that is involved in both pancreatic cancer and diabetes. It belongs to a wider family of proteins that share structural and functional similarities. Relatively little is known about this extended family, but evidence of regulatory
Franco Conforti et al.
Cell death discovery, 6, 54-54 (2020-07-09)
Idiopathic pulmonary fibrosis (IPF) is a chronic scarring disease in which aging, environmental exposure(s) and genetic susceptibility have been implicated in disease pathogenesis, however, the causes and mechanisms of the progressive fibrotic cascade are still poorly understood. As epithelial-mesenchymal interactions
Yi-Jye Chern et al.
Cell death & disease, 10(7), 504-504 (2019-06-28)
Therapy-refractory disease is one of the main contributors of treatment failure in cancer. In colorectal cancer (CRC), SPARC can function as a sensitizer to conventional chemotherapy by enhancing apoptosis by interfering with the activity of Bcl-2. Here, we examine a

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service