Skip to Content
Merck
All Photos(1)

Documents

EMU037611

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Twist1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGAGCTGGACTCCAAGATGGCAAGCTGCAGCTATGTGGCCCACGAGCGGCTCAGCTACGCCTTCTCCGTCTGGAGGATGGAGGGGGCCTGGTCCATGTCCGCGTCCCACTAGCAGCGGAGCTCCCCACCCCCTCTGCAGGCCGGAGACCTAGATGTCATTGTTTCCAGAGAAGGAGAAAATGGACAGTCTAGAGACTCTGGAGCTGGATAACTAAAAATAAATCTATATGACAAAGATTTTCATGGAAATTAGAAGAGCAGAGACCAAATTCACAAGAATCAGGGCGTGGGGCACACTTTTAAAAGAGAAAGCGAGACAGGCCCGTGGACAGAGATTCCCAGAGGGGCAGCAGCAGACCCCCCACACCTCTGCATTCTGATAGAAGTCTGAACACTCGTTTGTGTCCCCCCACCCCACTTTTTGACGAAGAATGTTTTATTTTTATTTTTCATGCATGCATTCTCAAGAGGTCTTGCCAATCAGCCACTGACAGGAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shasha Zheng et al.
Journal of immunology (Baltimore, Md. : 1950), 195(1), 217-226 (2015-05-29)
Proper regulation of microbial-induced cytokines is critical to intestinal immune homeostasis. Acute stimulation of nucleotide-binding oligomerization domain 2 (NOD2), the Crohn's disease-associated sensor of bacterial peptidoglycan, induces cytokines. However, chronic NOD2 stimulation in macrophages decreases cytokines upon pattern recognition receptor
Rosemarie Chirco D'Angelo et al.
Molecular cancer research : MCR, 12(9), 1324-1333 (2014-06-05)
Tissue inhibitor of metalloproteinase-1 (TIMP-1) regulates intracellular signaling networks for inhibition of apoptosis. Tetraspanin (CD63), a cell surface binding partner for TIMP-1, was previously shown to regulate integrin-mediated survival pathways in the human breast epithelial cell line MCF10A. In the
Lihua Yang et al.
Scientific reports, 5, 13677-13677 (2015-09-04)
Understanding the molecular mechanism by which epithelial mesenchymal transition (EMT)-mediated cancer metastasis and how microRNA (miRNA) regulates lung cancer progression via Twist1-activated EMT may provide potential therapeutic targets for cancer therapy. Here we found that miR-33a, an intronic miRNA located

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service