Skip to Content
Merck
All Photos(1)

Key Documents

EMU018541

Sigma-Aldrich

MISSION® esiRNA

targeting mouse F2rl1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
2 000,00 kr
50 μG
3 540,00 kr

2 000,00 kr


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
2 000,00 kr
50 μG
3 540,00 kr

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

2 000,00 kr


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGGCTGACCTCCTCTCTGTCATCTGGTTCCCCCTGGCCATTGCCTACCACCTACATGGCAACAACTGGGTCTATGGGGAGGCCCTGTGCAAGGTGCTCATTGGCTTTTTCTATGGCAACATGTATTGCTCCATCCTCTTCATGACCTGCCTCAGCGTGCAGAGGTACTGGGTGATCGTGAACCCCATGGGGCACCCCAGGAAGAAGGCAAACATCGCCGTTGGCGTCTCCTTGGCAATCTGGCTCCTGATTTTTCTGGTCACCATCCCTTTGTATGTCATGAAGCAGACCATCTACATTCCAGCCTTGAACATCACCACCTGCCACGATGTGCTGCCTGAGGAGGTATTGGTGGGGGACATGTTCAATTACTTCCTCTCACTGGCCATTGGAGTCTTCCTGTTCCCGGCCATCCTTACTGCATCTGCCTACGTGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... F2rl1(14063)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Noémie Michel et al.
Biological chemistry, 395(9), 1015-1025 (2014-03-20)
The dysregulated expression of kallikrein-related peptidase 6 (KLK6) is involved in non-small cancer (NSCLC) cell growth. However, the mechanism that sustains KLK6 signaling remains unknown. We used an isogenic non-small cell lung cancer (NSCLC) cell model system to demonstrate that
Sang E Lee et al.
The Journal of investigative dermatology, 135(9), 2219-2227 (2015-04-17)
Protease-activated receptor-2 (PAR-2) functions as innate biosensor for proteases and regulates numerous functions of the skin. However, the expression and physiological role of PAR-2 in sebocytes remain to be elucidated. Here, we identified PAR-2 expression in SZ95 sebocytes at both

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service