Skip to Content
Merck
All Photos(1)

Key Documents

EHU151431

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPG2

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
2 000,00 kr
50 μG
3 540,00 kr

2 000,00 kr


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
2 000,00 kr
50 μG
3 540,00 kr

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

2 000,00 kr


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTTTGCCTGCCACAGCTACAATGAGTGTGTGGCCCTGGAGTATCGCTGTGACCGGCGGCCCGACTGCAGGGACATGTCTGATGAGCTCAATTGTGAGGAGCCAGTCCTGGGTATCAGCCCCACATTCTCTCTCCTTGTGGAGACGACATCTTTACCGCCCCGGCCAGAGACAACCATCATGCGACAGCCACCAGTCACCCACGCTCCTCAGCCCCTGCTTCCCGGTTCCGTCAGGCCCCTGCCCTGTGGGCCCCAGGAGGCCGCATGCCGCAATGGGCACTGCATCCCCAGAGACTACCTCTGCGACGGACAGGAGGACTGCGAGGACGGCAGCGATGAGCTAGACTGTGGCCCCCCGCCACCCTGTGAGCCCAACGAGTTCCCCTGCGGGAATGGACATTGTGCCCTCAAGCTGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Osama Garwain et al.
Cellular signalling, 71, 109620-109620 (2020-04-05)
Alzheimer's disease is typified by calcium dysfunction and neurofibrillary tangles of tau aggregates along with mitotic proteins. Using PC12 cells as a model system, we determined whether the Gαq/PLCβ/ calcium signaling pathway impacts the manifestation of Alzheimer's disease. Down-regulating PLCβ
Anne M Roesler et al.
Journal of cellular physiology, 234(8), 14187-14197 (2019-01-10)
Airway smooth muscle (ASM) regulation of airway structure and contractility is critical in fetal/neonatal physiology in health and disease. Fetal lungs experience higher Ca2+ environment that may impact extracellular Ca2+ ([Ca2+ ]o ) sensing receptor (CaSR). Well-known in the parathyroid
Cristián Ibarra et al.
Molecular oncology, 13(2), 202-211 (2018-10-26)
Bacillus Calmette-Guérin (BCG) is widely used in the clinic to effectively treat superficial urinary bladder cancer. However, a significant proportion of patients who fail to respond to BCG risk cystectomy or death. Though more than 3 million cancer treatments with
Jeanne L Theis et al.
eLife, 9 (2020-10-03)
Congenital heart diseases (CHDs), including hypoplastic left heart syndrome (HLHS), are genetically complex and poorly understood. Here, a multidisciplinary platform was established to functionally evaluate novel CHD gene candidates, based on whole-genome and iPSC RNA sequencing of a HLHS family-trio.

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service