Skip to Content
Merck
All Photos(1)

Key Documents

EHU109721

Sigma-Aldrich

MISSION® esiRNA

targeting human UBA2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTAGCACCAGATGTCCAAATTGAAGATGGGAAAGGAACAATCCTAATATCTTCCGAAGAGGGAGAGACGGAAGCTAATAATCACAAGAAGTTGTCAGAATTTGGAATTAGAAATGGCAGCCGGCTTCAAGCAGATGACTTCCTCCAGGACTATACTTTATTGATCAACATCCTTCATAGTGAAGACCTAGGAAAGGACGTTGAATTTGAAGTTGTTGGTGATGCCCCGGAAAAAGTGGGGCCCAAACAAGCTGAAGATGCTGCCAAAAGCATAACCAATGGCAGTGATGATGGAGCTCAGCCCTCCACCTCCACAGCTCAAGAGCAAGATGACGTTCTCATAGTTGATTCAGATGAAGAAGATTCTTCAAATAATGCCGACGTCAGTGAAGAAGAGAGAAGCCGCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Biying Jiang et al.
Journal of cellular biochemistry, 120(8), 12752-12761 (2019-03-09)
Ubiquitin activating enzyme 2 (UBA2) is a basic component of E1-activating enzyme in the SUMOylation system. Expression and function of UBA2 in human cancers are largely unknown. In this study we investigate UBA2 expression the function in human non-small-cell lung
Xingyue He et al.
PloS one, 10(4), e0123882-e0123882 (2015-04-11)
SUMOylation is a post-translational ubiquitin-like protein modification pathway that regulates important cellular processes including chromosome structure, kinetochore function, chromosome segregation, nuclear and sub-nuclear organization, transcription and DNA damage repair. There is increasing evidence that the SUMO pathway is dysregulated in
Xiaoke Liu et al.
Journal of hematology & oncology, 8, 67-67 (2015-06-13)
SUMO-activating enzyme subunit 2 (SAE2) is the sole E1-activating enzyme required for numerous important protein SUMOylation, abnormal of which is associated with carcinogenesis. SAE2 inactivation was recently reported to be a therapeutic strategy in cancers with Myc overexpression. However, the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service