Skip to Content
Merck
All Photos(1)

Key Documents

EHU091731

Sigma-Aldrich

MISSION® esiRNA

targeting human MET

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
2 000,00 kr
50 μG
3 540,00 kr

2 000,00 kr


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
2 000,00 kr
50 μG
3 540,00 kr

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

2 000,00 kr


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCACATTGACCTCAGTGCTCTAAATCCAGAGCTGGTCCAGGCAGTGCAGCATGTAGTGATTGGGCCCAGTAGCCTGATTGTGCATTTCAATGAAGTCATAGGAAGAGGGCATTTTGGTTGTGTATATCATGGGACTTTGTTGGACAATGATGGCAAGAAAATTCACTGTGCTGTGAAATCCTTGAACAGAATCACTGACATAGGAGAAGTTTCCCAATTTCTGACCGAGGGAATCATCATGAAAGATTTTAGTCATCCCAATGTCCTCTCGCTCCTGGGAATCTGCCTGCGAAGTGAAGGGTCTCCGCTGGTGGTCCTACCATACATGAAACATGGAGATCTTCGAAATTTCATTCGAAATGAGACTCATAATCCAACTGTAAAAGATCTTATTGGCTTTGGTCTTCAAGTAGCCAAAGGCATGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Feng-Jie Lin et al.
Molecules and cells, 43(10), 856-869 (2020-10-30)
To elucidate the mechanism of action of HOXA11-AS in modulating the cisplatin resistance of nasopharyngeal carcinoma (NPC) cells. HOXA11-AS and miR-454-3p expression in NPC tissue and cisplatin-resistant NPC cells were measured via quantitative reverse transcriptase polymerase chain reaction. NPC parental
Demin Jiao et al.
Journal of cellular and molecular medicine, 22(7), 3526-3536 (2018-04-18)
Hepatocyte growth factor (HGF) overexpression is an important mechanism in acquired epidermal growth factor receptor (EGFR) kinase inhibitor gefitinib resistance in lung cancers with EGFR activating mutations. MiR-1-3p and miR-206 act as suppressors in lung cancer proliferation and metastasis. However
Qian-Qian Liu et al.
Journal of Zhejiang University. Science. B, 21(10), 779-795 (2020-10-13)
Verticillin A is a diketopiperazine compound which was previously isolated from Amanita flavorubescens Alk (containing parasitic fungi Hypomyces hyalines (Schw.) Tul.). Here, we initially found, by wound healing assay and Transwell assay in vitro, that verticillin A possesses an inhibitory
J van de Kamp et al.
Journal of tissue engineering and regenerative medicine, 11(11), 2988-2998 (2016-09-20)
Mesenchymal stem cells (MSC) are precursor cells of mesodermal tissue and, because of their trophic phenotype, they are known to play beneficial roles in wound healing. In addition, various tissue engineering strategies are based on MSC/biomaterial constructs. As the isolation
Jie Zhu et al.
Oncotarget, 8(65), 108665-108675 (2018-01-10)
Tumor necrosis factor-related apoptosis inducing ligand (TRAIL) induces apoptosis in malignant cells, but not in normal cells. As papillary thyroid carcinoma cells broadly expressed TRAIL receptors (death receptor 4 and death receptor 5) on their surface, TRAIL is considered as

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service