Skip to Content
Merck
All Photos(1)

Documents

EHU024671

Sigma-Aldrich

MISSION® esiRNA

targeting human ANXA1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGTGTTTCAGAAATACACCAAGTACAGTAAGCATGACATGAACAAAGTTCTGGACCTGGAGTTGAAAGGTGACATTGAGAAATGCCTCACAGCTATCGTGAAGTGCGCCACAAGCAAACCAGCTTTCTTTGCAGAGAAGCTTCATCAAGCCATGAAAGGTGTTGGAACTCGCCATAAGGCATTGATCAGGATTATGGTTTCCCGTTCTGAAATTGACATGAATGATATCAAAGCATTCTATCAGAAGATGTATGGTATCTCCCTTTGCCAAGCCATCCTGGATGAAACCAAAGGAGATTATGAGAAAATCCTGGTGGCTCTTTGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yin Zhao et al.
Biochimica et biophysica acta, 1863(6), 1350-1358 (2017-04-09)
The degeneration of retinal ganglion cells (RGCs) has been identified as a major problem in glaucoma. Previous studies have indicated an association between annexin A1 (ANXA1) and neuronal cell apoptosis, and RGCs apoptosis in acute ischemia-reperfusion was attributed to an
Hisashi Onozawa et al.
Oncology reports, 37(1), 235-240 (2016-11-15)
Resistance to 5-fluorouracil (5‑FU), a key drug in the treatment of colorectal cancer, is one of the major reasons for poor patient prognosis during cancer treatment. Annexin A1 (ANXA1) is a calcium‑dependent phospholipid‑linked protein that is associated with drug resistance, anti‑inflammatory effects
Chandrika Senthilkumaran et al.
Veterinary research, 46, 6-6 (2015-04-02)
Annexins A1 and A2 are proteins known to function in the stress response, dampening inflammatory responses and mediating fibrinolysis. We found, in healthy cattle recently arrived to a feedlot, that lower levels of these proteins correlated with later development of
Anjana Bhardwaj et al.
PloS one, 10(5), e0127678-e0127678 (2015-05-23)
Annexin A1 (ANXA1) is an anti-inflammatory protein reported to play a role in cell proliferation and apoptosis, and to be deregulated in breast cancer. The exact role of annexin A1 in the biology of breast cancer remains unclear. We hypothesized

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service