Skip to Content
Merck
All Photos(1)

Key Documents

EHU006581

Sigma-Aldrich

MISSION® esiRNA

targeting human SUFU

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
2 000,00 kr
50 μG
3 540,00 kr

2 000,00 kr


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
2 000,00 kr
50 μG
3 540,00 kr

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

2 000,00 kr


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTTTGAGTTGACCTTTCGTCTGAAGAGAGAAACTGGGGAGTCTGCCCCACCAACATGGCCCGCAGAGTTAATGCAGGGCTTGGCACGATACGTGTTCCAGTCAGAGAACACCTTCTGCAGTGGGGACCATGTGTCCTGGCACAGCCCTTTGGATAACAGTGAGTCAAGAATTCAGCACATGCTGCTGACAGAGGACCCACAGATGCAGCCCGTGCAGACACCCTTTGGGGTAGTTACCTTCCTCCAGATCGTTGGTGTCTGCACTGAAGAGCTACACTCAGCCCAGCAGTGGAACGGGCAGGGCATCCTGGAGCTGCTGCGGACAGTGCCTATTGCTGGCGGCCCCTGGCTGATAACTGACATGCGGAGGGGAGAGACCATATTTGAGATCGATCCACACCTGCAAGAGAGAGTTGACAAAGGCATCGAGACAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yin Peng et al.
Cell cycle (Georgetown, Tex.), 19(20), 2720-2733 (2020-10-06)
The poor prognosis of late gastric carcinomas (GC) underscores the necessity to identify novel biomarkers for earlier diagnosis and effective therapeutic targets. MiRNA-324-5p has been shown to be over-expressed in GC, however the biological function of miRNA-324-5p implicated in gastric
Yin Peng et al.
Cancer letters, 385, 117-127 (2016-11-05)
Emerging evidence has shown that miRNA-194 is aberrantly upregulated in gastric cancer (GC); however, the biological mechanisms underlying its involvement are largely unknown. Wnt/β-catenin signaling has been implicated in gastric tumorigenesis; we therefore hypothesized that miRNA-194 promotes gastric carcinogenesis by
Bo Ram Kim et al.
Cell death and differentiation, 27(2), 676-694 (2019-07-07)
Disabled tumor suppressor genes and hyperactive oncogenes greatly contribute to cell fates during cancer development because of their genetic alterations such as somatic mutations. However, little is known about how tumor suppressor genes react to diverse oncogenes during tumor progression.

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service