Skip to Content
Merck
All Photos(1)

Key Documents

EHU108071

Sigma-Aldrich

MISSION® esiRNA

targeting human SCD

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATCATTGCCAACACAATGGCATTCCAGAATGATGTCTATGAATGGGCTCGTGACCACCGTGCCCACCACAAGTTTTCAGAAACACATGCTGATCCTCATAATTCCCGACGTGGCTTTTTCTTCTCTCACGTGGGTTGGCTGCTTGTGCGCAAACACCCAGCTGTCAAAGAGAAGGGGAGTACGCTAGACTTGTCTGACCTAGAAGCTGAGAAACTGGTGATGTTCCAGAGGAGGTACTACAAACCTGGCTTGCTGATGATGTGCTTCATCCTGCCCACGCTTGTGCCCTGGTATTTCTGGGGTGAAACTTTTCAAAACAGTGTGTTCGTTGCCACTTTCTTGCGATATGCTGTGGTGCTTAATGCCACCTGGCTGGTGAACAGTGCTGCCCACCTCTTCGGATATCGTCCTTATGACAAGAACATTAGCCCCCGGGAGAATATCCTGGTTTCACTTGGAGCTGTGGGTGAGGGCTTCCACAACTACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lei Li et al.
PloS one, 8(9), e75104-e75104 (2013-09-27)
Increased de novo lipogenesis is one of the major metabolic events in cancer. In human hepatocellular carcinoma (HCC), de novo lipogenesis has been found to be increased and associated with the activation of AKT/mTOR signaling. In mice, overexpression of an
Mohamed Amine Lounis et al.
Cancers, 12(11) (2020-11-15)
De novo lipogenesis (DNL) is now considered as a hallmark of cancer. The overexpression of key enzymes of DNL is characteristic of both primary and advanced disease and may play an important role in resistance to therapies. Here, we showed
Youping Zhou et al.
Aging, 12(8), 7350-7362 (2020-04-24)
SCD1 is a key enzyme controlling lipid metabolism and a link between its activity and NAFLD has been proposed. Lipophagy is a novel regulatory approach to lipid metabolism regulation, which is involved in the development of NAFLD. However, the possible
Dawei Yao et al.
Journal of cellular physiology, 232(3), 635-649 (2016-06-25)
Stearoyl-CoA desaturase 1 (SCD1) is a key enzyme for the synthesis of the monounsaturated fatty acids (MUFA) palmitoleic acid and oleic acid. In non-ruminant species, SCD1 expression is known to be tightly regulated by a variety of transcription factors. Although
Yurena Vivas-García et al.
Molecular cell, 77(1), 120-137 (2019-11-18)
Phenotypic and metabolic heterogeneity within tumors is a major barrier to effective cancer therapy. How metabolism is implicated in specific phenotypes and whether lineage-restricted mechanisms control key metabolic vulnerabilities remain poorly understood. In melanoma, downregulation of the lineage addiction oncogene

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service