Skip to Content
Merck
All Photos(1)

Key Documents

EHU002651

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP1LC3B

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAAGTGAGCACATTCAGCTTTGGAAACTATATTATTTAATGTAGGCTAGCTTGTTTTCAAATTTTAAAAGTTTAAAAATAAAATACTTTGCATTCTAAGTTGCCAATAAAATAGACCTTCAAGTTATTTTAATGCTCTTTTCTCACTAATAGGAACTTGTAATTCCAGCAGTAATTTAAAGGCTTTCAGAGAGACCCTGAGTCTTCTCTTCAGGTTCACAAAACCCGCCGCCTTTTTGGGTAGAAGTTTTCTACTCAGCTAGAGAGATCTCCCTAAGAGGATCTTTAGGCCTGAGTTGTGAAGCGCAACCCCCGCAAAACGCATTTGCCATCACAGTTGGCACAAACGCAGGGTAAACGGGCTGTGTGAGAAAACGGCCCTGACTGTAAACTGCTGAAGGTCCCTGACTCCTAAGAGAACCACACCCAAAGTCCTCACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yujie Yang et al.
International journal of molecular sciences, 21(10) (2020-05-18)
The aryl hydrocarbon receptor (AHR) is an environmental sensing molecule which impacts diverse cellular functions such as immune responses, cell growth, respiratory function, and hematopoietic stem cell differentiation. It is widely accepted that the degradation of AHR by 26S proteasome
Rong Yu et al.
Cancer cell international, 14, 49-49 (2014-07-06)
Hepatocellular carcinoma (HCC), the primary liver cancer, is one of the most malignant human tumors with extremely poor prognosis. The aim of this study was to investigate the anti-cancer effect of berberine in a human hepatocellular carcinoma cell line (HepG2)
Tamotsu Tsukahara et al.
BioMed research international, 2013, 204973-204973 (2013-11-30)
Our previous study demonstrated that PTB-associated splicing factor (PSF) is an important regulator of cell death and plays critical roles in the survival and growth of colon cancer cells. However, the molecular mechanism that activates these downstream signaling events remains
Narae Hwang et al.
BMB reports, 53(5), 284-289 (2020-04-23)
Tamoxifen, a nonsteroidal estrogen receptor (ER) antagonist, is used routinely as a chemotherapeutic agent for ER-positive breast cancer. However, it is also causes side effects, including retinotoxicity. The retinal pigment epithelium (RPE) has been recognized as the primary target of
Saroj Nepal et al.
Biomolecules & therapeutics, 22(5), 384-389 (2014-11-22)
Adiponectin, an adipokine predominantly secreted from adipose tissue, exhibits diverse biological responses, including metabolism of glucose and lipid, and apoptosis in cancer cells. Recently, adiponectin has been shown to modulate autophagy as well. While emerging evidence has demonstrated that autophagy

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service