Skip to Content
Merck
All Photos(1)

Key Documents

EHU135251

Sigma-Aldrich

MISSION® esiRNA

targeting human HIPK2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGGCCGTTATATCCAGGAGCTTCGGAGTATGATCAGATTCGGTATATTTCACAAACACAGGGTTTGCCTGCTGAATATTTATTAAGCGCCGGGACAAAGACAACTAGGTTTTTCAACCGTGACACGGACTCACCATATCCTTTGTGGAGACTGAAGACACCAGATGACCATGAAGCAGAGACAGGGATTAAGTCAAAAGAAGCAAGAAAGTACATTTTCAACTGTTTAGATGATATGGCCCAGGTGAACATGACGACAGATTTGGAAGGGAGCGACATGTTGGTAGAAAAGGCTGACCGGCGGGAGTTCATTGACCTGTTGAAGAAGATGCTGACCATTGATGCTGACAAGAGAATCACTCCAATCGAAACCCTGAACCATCCCTTTGTCACCATGACACACTTACTCGATTTTCCCCACAGC

Ensembl | human accession no.

ENSG00000064393

NCBI accession no.

NM_001113239

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HIPK2(28996) , HIPK2(28996)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yi-Xuan Zhao et al.
Annals of plastic surgery, 79(6), 546-551 (2017-10-21)
Epithelial-mesenchymal transition (EMT) plays a critical role in fibrotic keloid formation, which is characterized by excessive collagen and extracellular matrix synthesis and deposition. Growing evidence suggests that the serine/threonine kinase homeodomain-interacting protein kinase 2 (HIPK2) acts upstream of several major
Zhengyu Jiang et al.
Cell death & disease, 9(9), 847-847 (2018-08-30)
Sepsis is the leading cause of death in intensive care units worldwide. Autophagy has recently been shown to protect against sepsis-induced liver injury. Here, we investigated the roles of homeodomain-interacting protein kinase 2 (HIPK2) in the molecular mechanism of sepsis-induced
Xiaoyan Dang et al.
Chemico-biological interactions, 316, 108922-108922 (2019-12-15)
Homeodomain interacting protein kinase-2 (HIPK2) has emerged as a crucial stress-responsive kinase that plays a critical role in regulating cell survival and apoptosis. However, whether HIPK2 participates in regulating cardiomyocyte survival during myocardial ischemia/reperfusion injury remains unclear. Here, we investigated
Luyang Xu et al.
Theranostics, 9(9), 2712-2726 (2019-05-28)
The molecular mechanism underlying the transition of acute kidney injury (AKI) to chronic kidney disease (CKD) induced by vancomycin (VAN) remains largely unknown. Methods: The mice model of VAN drives AKI to CKD was developed to investigate the role and
Xianhui Wen et al.
Experimental and therapeutic medicine, 21(4), 355-355 (2021-03-19)
Currently, bone marrow transplantation remains the basic treatment for various hematological tumors and irradiation is one of the most important pretreatment methods. However, irradiation pretreatment may result in damage to bone mesenchymal stem cells (BMSCs). The present study aimed to
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service