Skip to Content
Merck
All Photos(1)

Key Documents

EHU047921

Sigma-Aldrich

MISSION® esiRNA

targeting human UBR5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAATTCAGCGGGTTTGATTTATATTGATCCTTCAAACTTACGCCGGAGTGGTACCATCAGTACAAGTGCTGCAGCTGCAGCAGCTGCTTTGGAAGCTAGCAACGCCAGCAGTTACCTAACATCTGCAAGCAGTTTAGCCAGGGCTTACAGCATTGTCATTAGACAAATCTCGGACTTGATGGGCCTTATTCCTAAGTATAATCACCTAGTATACTCTCAGATTCCAGCAGCTGTGAAATTGACTTACCAAGATGCAGTAAACTTACAGAACTATGTAGAAGAAAAGCTTATTCCCACTTGGAACTGGATGGTCAGTATTATGGATTCTACTGAAGCTCAATTACGTTATGGTTCTGCATTAGCATCTGCTGGTGATCCTGGACATCCAAATCATCCTCTTCACGCTTCTCAGAATTCAGCGAGAAGAGAGAGGATGACTGCGCGAGAAGAAGCTAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fanghui Ding et al.
Experimental and therapeutic medicine, 20(5), 7-7 (2020-09-17)
The human ubiquitin protein ligase E3 component N-recognin 5 (UBR5) gene, which is localized to chromosome 8q22, encodes an ~10 kb mRNA and a >300 kDa protein, which can be detected in a number of cell types. UBR5 is implicated
Caiyun G Li et al.
Cell reports, 26(5), 1333-1343 (2019-01-31)
Using proteomic approaches, we uncovered a DNA damage response (DDR) function for peroxisome proliferator activated receptor γ (PPARγ) through its interaction with the DNA damage sensor MRE11-RAD50-NBS1 (MRN) and the E3 ubiquitin ligase UBR5. We show that PPARγ promotes ATM

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service