Skip to Content
Merck
All Photos(1)

Key Documents

EHU033921

Sigma-Aldrich

MISSION® esiRNA

targeting human TUFM

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAGGGAGACGAGTGTGAGCTCCTAGGACATAGCAAGAACATCCGCACTGTGGTGACAGGCATTGAGATGTTCCACAAGAGCCTGGAGAGGGCCGAGGCCGGAGATAACCTCGGGGCCCTGGTCCGAGGCTTGAAGCGGGAGGACTTGCGGCGGGGCCTGGTCATGGTCAAGCCAGGTTCCATCAAGCCCCACCAGAAGGTGGAGGCCCAGGTTTACATCCTCAGCAAGGAGGAAGGTGGCCGCCACAAGCCCTTTGTGTCCCACTTCATGCCTGTCATGTTCTCCCTGACTTGGGACATGGCCTGTCGGATTATCCTGCCCCCAGAGAAGGAGCTTGCCATGCCCGGGGAGGACCTGAAGTTCAACCTAATCTTGCGGCAGCCAATGATCTTAGAGAAAGGCCAGCGTTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaoyuan Weng et al.
Oncology letters, 20(5), 250-250 (2020-10-01)
Gastrointestinal stromal tumors (GISTs) are the most common pathologic type of mesenchymal tumor in the digestive tract. Patients with GIST face the risk of metastasis, postoperative recurrence and imatinib mesylate (IM) resistance. Mitochondrial Tu translation elongation factor (TUFM) is highly
Keiichi Tamai et al.
Scientific reports, 10(1), 21592-21592 (2020-12-11)
Cancer stem cells (CSCs) define a subpopulation of cancer cells that are resistant to therapy. However, little is known of how CSC characteristics are regulated. We previously showed that dormant cancer stem cells are enriched with a CD274low fraction of
Dasol Kim et al.
Communications biology, 4(1), 1-1 (2021-01-06)
Disorders of autophagy, a key regulator of cellular homeostasis, cause a number of human diseases. Due to the role of autophagy in metabolic dysregulation, there is a need to identify autophagy regulators as therapeutic targets. To address this need, we

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service