Skip to Content
Merck
All Photos(1)

Key Documents

EHU015411

Sigma-Aldrich

MISSION® esiRNA

targeting human DAPK1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAATGTATCCGCTGTCAACTACGAATTTGAGGATGAATACTTCAGTAATACCAGTGCCCTAGCCAAAGATTTCATAAGAAGACTTCTGGTCAAGGATCCAAAGAAGAGAATGACAATTCAAGATAGTTTGCAGCATCCCTGGATCAAGCCTAAAGATACACAACAGGCACTTAGTAGAAAAGCATCAGCAGTAAACATGGAGAAATTCAAGAAGTTTGCAGCCCGGAAAAAATGGAAACAATCCGTTCGCTTGATATCACTGTGCCAAAGATTATCCAGGTCATTCCTGTCCAGAAGTAACATGAGTGTTGCCAGAAGCGATGATACTCTGGATGAGGAAGACTCCTTTGTGATGAAAGCCATCATCCATGCCATCAACGATGACAATGTCCCAGGCCTGCAGCACCTTCTGGGCTCATTATCCA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhenning Liu et al.
Immunologic research, 65(3), 687-698 (2017-02-20)
Paraquat can result in dysfunction of multiple organs after ingestion in human. However, the mechanisms of nucleotide-binding domain and leucine-rich repeat containing protein 3 (NLRP3) inflammasome activation in acute kidney injury have not been clearly demonstrated. The aim of this
Chang-Lin Zhai et al.
IUBMB life, 71(2), 166-176 (2018-11-13)
Cardiovascular ischemic disease is a large class of diseases that are harmful to human health. The significant role of microRNAs (miRNAs) in terms of controlling cardiac injury has been reported in latest studies. MiR-98 is very important in regulating the
Wei Xiong et al.
Journal of the neurological sciences, 387, 210-219 (2018-03-25)
Death-associated protein kinase 1 (DAPK1) is a kinase found to promote neuronal apoptosis induced by ischemia. Extracellular signal-regulated kinase (ERK) was identified as a key molecule in DAPK1 signaling. However, the mechanisms of neuronal ischemia reperfusion injury remain unknown. Here
Bang-Chuan Hu et al.
Theranostics, 10(25), 11479-11496 (2020-10-15)
Tubular damage initiated by inflammatory response and ischemic/hypoxic stress is a hallmark of septic acute kidney injury (AKI), albeit the molecular mechanism coupling the two events remains unclear. We investigated the intrinsic nature of tubular damage with respect to inflammatory/hypoxic
Jean-Cheng Kuo et al.
The Journal of cell biology, 172(4), 619-631 (2006-02-16)
Death-associated protein kinase (DAPK) is a calmodulin-regulated serine/threonine kinase and possesses apoptotic and tumor-suppressive functions. However, it is unclear whether DAPK elicits apoptosis-independent activity to suppress tumor progression. We show that DAPK inhibits random migration by reducing directional persistence and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service