Skip to Content
Merck
All Photos(1)

Key Documents

EMU090601

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fli1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACCAGCCAGTGAGAGTCAATGTCAAGCGGGAGTATGACCACATGAATGGATCCAGGGAGTCTCCGGTGGACTGCAGTGTCAGCAAATGTAACAAGCTGGTGGGCGGAGGCGAAGCCAACCCCATGAACTATAATAGCTACATGGATGAGAAGAACGGCCCCCCTCCTCCCAACATGACCACCAACGAACGGAGAGTCATTGTGCCTGCAGACCCCACACTGTGGACACAGGAGCACGTTCGACAGTGGCTGGAGTGGGCTATAAAGGAATACGGATTGATGGAGATTGACACTTCCTTCTTCCAGAACATGGATGGCAAGGAATTGTGTAAAATGAACAAGGAGGACTTCCTCCGAGCCACCTCCGCCTACAACACAGAAGTGCTGTTGTCGCACCTCAGTTACCTCAGGGAAAGTTCACTGCTGGCCTATAACACAACCTCCCATACAGACCAGTCCTCACGACTGAATGTCAAGGAAGACCCTTCTTATGACTCTGTCAGGAGAGGAGCATGGAACAATAATATGAACTCTGGCCTCAACAAAAGTCCTCTCCTTGGAGGATCACA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Melissa N Scheiber et al.
Neoplasia (New York, N.Y.), 16(10), 801-813 (2014-11-08)
ETS factors have been shown to be dysregulated in breast cancer. ETS factors control the expression of genes involved in many biological processes, such as cellular proliferation, differentiation, and apoptosis. FLI1 is an ETS protein aberrantly expressed in retrovirus-induced hematological
Mara L Lennard Richard et al.
Journal of immunology (Baltimore, Md. : 1950), 193(6), 2661-2668 (2014-08-08)
The friend leukemia insertion site 1 (Fli-1) transcription factor, an Ets family member, is implicated in the pathogenesis of systemic lupus erythematosus in human patients and murine models of lupus. Lupus-prone mice with reduced Fli-1 expression have significantly less nephritis

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service