Skip to Content
Merck
All Photos(1)

Documents

EMU084221

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dnm1l

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCAACATCAGAAGCACTCAAGATTTCCAGAGAGGTAGATCCAGATGGGCGCAGAACTCTAGCTGTAATCACTAAACTTGATCTCATGGATGCGGGTACTGATGCCATGGATGTATTGATGGGAAGGGTTATTCCAGTCAAGCTTGGAATAATTGGAGTAGTTAACAGAAGCCAACTGGATATTAACAATAAGAAGAGTGTAACTGATTCAATCCGTGATGAGTATGCTTTTCTTCAAAAGAAGTACCCATCTCTGGCCAACAGAAATGGAACAAAGTATCTTGCTAGGACCCTGAATAGGTTACTTATGCATCATATCAGAGATTGTTTACCAGAGCTGAAAACAAGAATAAATGTCTTAGCTGCTCGGTATCAGTCTCTTCTAAATAGCTATGGTGAACCGGTGGATGATAAAAGTGCTACTTTACTCCAGCTTATTACCAAATTTGCCACAGAGTATTGTAACACGATTGAAGGAACCGCAAAGTACA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bharathi Aravamudan et al.
American journal of physiology. Lung cellular and molecular physiology, 306(9), L840-L854 (2014-03-13)
The balance between mitochondrial fission and fusion is crucial for mitochondria to perform its normal cellular functions. We hypothesized that cigarette smoke (CS) disrupts this balance and enhances mitochondrial dysfunction in the airway. In nonasthmatic human airway smooth muscle (ASM)
Mabel Lum et al.
International journal of medical microbiology : IJMM, 304(5-6), 530-541 (2014-04-24)
Shigella infection in epithelial cells induces cell death which is accompanied by mitochondrial dysfunction. In this study the role of the mitochondrial fission protein, Drp1 during Shigella infection in HeLa cells was examined. Significant lactate dehydrogenase (LDH) release was detected
Jing Zhou et al.
Autophagy, 11(8), 1259-1279 (2015-06-27)
Autophagy inhibition has been widely accepted as a promising therapeutic strategy in cancer, while the lack of effective and specific autophagy inhibitors hinders its application. Here we found that liensinine, a major isoquinoline alkaloid, inhibits late-stage autophagy/mitophagy through blocking autophagosome-lysosome

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service