Skip to Content
Merck
All Photos(1)

Key Documents

EHU109791

Sigma-Aldrich

MISSION® esiRNA

targeting human RPSA

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCTCACGGAGGCATCTTATGTTAACCTACCTACCATTGCGCTGTGTAACACAGATTCTCCTCTGCGCTATGTGGACATTGCCATCCCATGCAACAACAAGGGAGCTCACTCAGTGGGTTTGATGTGGTGGATGCTGGCTCGGGAAGTTCTGCGCATGCGTGGCACCATTTCCCGTGAACACCCATGGGAGGTCATGCCTGATCTGTACTTCTACAGAGATCCTGAAGAGATTGAAAAAGAAGAGCAGGCTGCTGCTGAGAAGGCAGTGACCAAGGAGGAATTTCAGGGTGAATGGACTGCTCCCGCTCCTGAGTTCACTGCTACTCAGCCTGAGGTTGCAGACTGGTCTGAAGGTGTACAGGTGCCCTCTGTGCCTATTCAGCAATTCCCTACTGAAGACTGGAGCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kiashanee Moodley et al.
PloS one, 8(3), e57409-e57409 (2013-03-09)
The non-integrin laminin receptor, here designated the 37-kDa/67-kDa laminin receptor (LRP/LR), is involved in many physiologically relevant processes, as well as numerous pathological conditions. The overexpression of LRP/LR on various cancerous cell lines plays critical roles in tumour metastasis and
Thandokuhle Khumalo et al.
PloS one, 10(10), e0139584-e0139584 (2015-10-02)
Cancer is a global burden due to high incidence and mortality rates and is ranked the second most diagnosed disease amongst non-communicable diseases in South Africa. A high expression level of the 37kDa/67kDa laminin receptor (LRP/LR) is one characteristic of
Guanhong Luo et al.
Oncotarget, 8(42), 71630-71641 (2017-10-27)
Cellular prion protein (PrPC), the infective agent of transmissible spongiform encephalopathies, is thought to be related to several cellular physiological and physiopathological processes. We have previously reported that PrPC participates in multi-drug-resistance of gastric cancer. As the salient ligand molecule
Carryn J Chetty et al.
Experimental cell research, 360(2), 264-272 (2017-09-14)
The 37kDa/67kDa laminin receptor (LRP/LR) serves various physiological and pathological roles such as enhancing tumour-related processes including metastasis, angiogenesis, cellular viability and telomerase activation in cancerous cell lines. The present study investigates the effect of siRNA mediated downregulation of LRP/LR

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service