Skip to Content
Merck
All Photos(1)

Key Documents

EHU051511

Sigma-Aldrich

MISSION® esiRNA

targeting human LNPK

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGAGAAGAGGCAGGTGGTGGAAGGTTCAAGTTCAGTTGGTCCCTTGCCATCAGGAAGTGTGCTTTCATCAGACAACCAGTTTAATGAAGAATCTTTAGAACACGATGTTCTTGATGATAATACAGAGCAGACAGATGACAAAATACCAGCTACAGAACAGACAAACCAAGTGATTGAAAAAGCATCTGACTCAGAGGAACCAGAGGAGAAACAAGAGACTGAGAATGAGGAAGCCTCAGTGATTGAAACCAACTCCACAGTTCCTGGAGCTGATTCTATTCCTGATCCTGAACTAAGTGGAGAATCTTTGACGGCAGAGTAGTAAATGCTTCCACGTGCCTTCAACTGGATATTTATAGTCTTACTGATGTCAGTTATTGCTTTTTCGGTGGCACTTAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jian-Bin Qiao et al.
Journal of controlled release : official journal of the Controlled Release Society, 321, 629-640 (2020-03-07)
Liver fibrosis leads to over one million deaths annually worldwide. Hepatic stellate cells (HSCs) have been identified as the main executors of liver fibrosis. Unfortunately, no drug has yet been approved for clinical use against liver fibrosis, largely because the
Genc Basha et al.
Molecular therapy. Nucleic acids, 5(9), e363-e363 (2016-09-14)
Sclerostin is a protein secreted by osteocytes that is encoded by the SOST gene; it decreases bone formation by reducing osteoblast differentiation through inhibition of the Wnt signaling pathway. Silencing the SOST gene using RNA interference (RNAi) could therefore be
Kaishun Zhao et al.
Aging, 12(10), 9125-9138 (2020-05-29)
Inflammation is an important cause of chronic obstructive pulmonary disease (COPD) and its acute exacerbation. However, the critical role of C-C chemokine receptor (CCR)1 in progression of cigarette smoke-induced chronic inflammation remains unclear. We studied CCR1 expression using immunohistochemistry, immunofluorescence
Kasra Khalaj et al.
Scientific reports, 7(1), 5883-5883 (2017-07-21)
Endometriosis, a major reproductive pathology affecting 8-10% of women is characterized by chronic inflammation and immune dysfunction. Human antigen R (HuR) and Tristetraprolin (TTP) are RNA binding proteins that competitively bind to cytokines involved in inflammation including: tumor necrosis factor
Ayaka Okamoto et al.
Biochemical and biophysical research communications, 449(4), 460-465 (2014-05-24)
An Fab' antibody against heparin-binding epidermal growth factor-like growth factor (HB-EGF) was applied to achieve advanced tumor-targeted delivery of siRNA. Lipid nanoparticles (LNP) encapsulating siRNA (LNP-siRNA) were prepared, pegylated, and surface modified with Fab' fragments of anti-HB-EGF antibody (αHB-EGF LNP-siRNA).

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service