Skip to Content
Merck
All Photos(1)

Key Documents

EHU044311

Sigma-Aldrich

MISSION® esiRNA

targeting human OLR1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGACCAGCCTGATGAGAAGTCAAATGGAAAAAAAGCTAAAGGTCTTCAGTTTCTTTACTCTCCATGGTGGTGCCTGGCTGCTGCGACTCTAGGGGTCCTTTGCCTGGGATTAGTAGTGACCATTATGGTGCTGGGCATGCAATTATCCCAGGTGTCTGACCTCCTAACACAAGAGCAAGCAAACCTAACTCACCAGAAAAAGAAACTGGAGGGACAGATCTCAGCCCGGCAACAAGCAGAAGAAGCTTCACAGGAGTCAGAAAACGAACTCAAGGAAATGATAGAAACCCTTGCTCGGAAGCTGAATGAGAAATCCAAAGAGCAAATGGAACTTCACCACCAGAATCTGAATCTCCAAGAAACACTGAAGAGAGTAGCAAATTGTTCAGCTCCTTGTCCGCAAGACTGGATCTGGCATGGAGAAAACTGTTACCTATTTTCCTCGGGCTCATTTAACTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Baonian Liu et al.
Biochemical and biophysical research communications, 508(4), 1113-1119 (2018-12-17)
Immune responses against antigens generally require an efficient activation of antigen-presenting cells (APCs). Currently, the targeting of vaccine antigens to APCs has emerged as a promising strategy for boosting vaccine immunogenicity. Here, we reported that the C-terminus of heat shock
Monica Villa et al.
Biochemical and biophysical research communications, 524(3), 696-701 (2020-02-09)
Inflammatory signals associated with cardiac diseases trigger trans-differentiation of cardiac fibroblasts to cardiac myofibroblasts. Cardiac myofibroblasts are the main cell type involved in the development of cardiac fibrosis, a diffuse and disproportionate accumulation of collagen in the myocardium. Although the
Tao Liu et al.
The Canadian journal of cardiology, 31(10), 1272-1281 (2015-06-23)
Lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) is a membrane protein associated with apoptosis. Endoplasmic reticulum (ER) stress-induced apoptosis has been determined in several cardiovascular diseases. Mitogen-activated protein kinase (MAPK) signalling is involved in apoptosis. The aim of this study was
Chao-Hung Chen et al.
Journal of diabetes investigation, 11(3), 535-544 (2019-10-10)
Electronegative low-density lipoprotein (L5) is the most atherogenic fraction of low-density lipoprotein and is elevated in people with metabolic syndrome (MetS), whereas the retinol-binding protein 4 receptor (stimulated by retinoic acid 6 [STRA6]) cascade is disrupted in various organs of patients with
Zufeng Ding et al.
International journal of cardiology, 184, 86-95 (2015-02-24)
Shear stress, autophagy and LOX-1 are important players in atherogenesis. Direct impact of shear stress on autophagy development in endothelial cells and role of LOX-1 therein are undelineated. A parallel-plate flow chamber was used to vary shear stress (3 to

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service