Skip to Content
Merck
All Photos(1)

Key Documents

EHU159481

Sigma-Aldrich

MISSION® esiRNA

targeting human NCOR2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCACGAGGTGTCAGAGATCATCGATGGCCTCTCAGAGCAGGAGAACCTGGAGAAGCAGATGCGCCAGCTGGCCGTGATCCCGCCCATGCTGTACGACGCTGACCAGCAGCGCATCAAGTTCATCAACATGAACGGGCTTATGGCCGACCCCATGAAGGTGTACAAAGACCGCCAGGTCATGAACATGTGGAGTGAGCAGGAGAAGGAGACCTTCCGGGAGAAGTTCATGCAGCATCCCAAGAACTTTGGCCTGATCGCATCATTCCTGGAGAGGAAGACAGTGGCTGAGTGCGTCCTCTATTACTACCTGACTAAGAAGAATGAGAACTATAAGAGCCTGGTGAGACGGAGCTATCGGCGCCGCGGCAAGAGCCAGCAGCAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCCATGCCCCGCAGCAGCCAGGAGGAGAAAGATGAGAAGGAGAAGGAAAAGGAGGCGGAGAAGGAGGAGGAGAAGCCGGAGGTGGAGAACGACAAGGAA

Ensembl | human accession no.

ENSG00000196498

NCBI accession no.

NM_001077261

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NCOR2(9612) , NCOR2(9612)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ligand Activation of PPARγ by Ligustrazine Suppresses Pericyte Functions of Hepatic Stellate Cells via SMRT-Mediated Transrepression of HIF-1α.
Feng Zhang et al.
Theranostics, 8(3), 610-626 (2018-01-19)
R S Al-Lamki et al.
Cell death & disease, 7(6), e2287-e2287 (2016-07-01)
We previously reported that renal clear cell carcinoma cells (RCC) express both tumor necrosis factor receptor (TNFR)-1 and -2, but that, in organ culture, a TNF mutein that only engages TNFR1, but not TNFR2, causes extensive cell death. Some RCC
Jil Sander et al.
Immunity, 47(6), 1051-1066 (2017-12-21)
Human in vitro generated monocyte-derived dendritic cells (moDCs) and macrophages are used clinically, e.g., to induce immunity against cancer. However, their physiological counterparts, ontogeny, transcriptional regulation, and heterogeneity remains largely unknown, hampering their clinical use. High-dimensional techniques were used to elucidate transcriptional, phenotypic
Nikhil Sharma et al.
Neuron, 102(2), 390-406 (2019-03-09)
Neuronal activity-dependent transcription is tuned to ensure precise gene induction during periods of heightened synaptic activity, allowing for appropriate responses of activated neurons within neural circuits. The consequences of aberrant induction of activity-dependent genes on neuronal physiology are not yet

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service