Skip to Content
Merck
All Photos(1)

Documents

EHU018671

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD4

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGCCATAGACAAGGTGGAGAGAGTGAAACATTTGCAAAAAGAGCAATTGAAAGTTTGGTAAAGAAGCTGAAGGAGAAAAAAGATGAATTGGATTCTTTAATAACAGCTATAACTACAAATGGAGCTCATCCTAGTAAATGTGTTACCATACAGAGAACATTGGATGGGAGGCTTCAGGTGGCTGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTCTGGAGGTGGCCTGATCTTCACAAAAATGAACTAAAACATGTTAAATATTGTCAGTATGCGTTTGACTTAAAATGTGATAGTGTCTGTGTGAATCCATATCACTACGAACGAGTTGTATCACCTGGAATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCATCAAGTATGATGGTGAAGGATGAATATGTGCATGACTTTGAGGGACAGCCATCGTTGTCCACTGAAGGACATTCAATTCAAACCATCCAGCATCCACCAAGTAATCGTGCATCG

Ensembl | human accession no.

ENSG00000141646

NCBI accession no.

NM_005359

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SMAD4(4089) , SMAD4(4089)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mao Ding et al.
Journal of experimental & clinical cancer research : CR, 39(1), 28-28 (2020-02-06)
Sirtuin-7 (SIRT7) is associated with the maintenance of tumorigenesis. However, its functional roles and oncogenic mechanisms in prostate cancer (PCa) are poorly understood. Here, we investigated the roles and underlying molecular mechanisms of SIRT7 in PCa cell growth and androgen-induced
Ryotaro Ogawa et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(9), 2887-2899 (2019-02-02)
SMAD4 is a key transcriptional factor of TGFβ signaling and acts as a tumor suppressor in colorectal cancer. In the present study, we explored the immunologic effect of SMAD4 on the tumor microenvironment. Using 99 clinical specimens and human colorectal
Xiaojiang Tang et al.
Journal of cellular biochemistry, 121(11), 4642-4653 (2020-02-13)
As an aggressive breast cancer (BCa) subtype, triple-negative breast cancer (TNBC) responses poorly to chemotherapy and endocrine therapy, and usually has a worse prognosis. This is largely due to the lack of specific therapeutic targets, laying claim to an imperious
Danyang Chao et al.
Biochemical and biophysical research communications, 509(2), 535-540 (2019-01-02)
AZD3759 is a tyrosine kinase inhibitor and has an encouraging future in treating brain metastases of non-small cell lung cancer. Here, we determined that AZD3759 suppressed the viability of HepG2 cells, a hepatoma cell line, and induced their apoptosis, suggesting
Ri Youn Kim et al.
Tissue engineering. Part A, 21(13-14), 2076-2088 (2015-04-04)
Clinical data show that estrogen levels are inversely associated with the production of sclerostin, a Wnt antagonist that recently attracted great attention over the use of its antibody in the anabolic treatment of osteoporotic conditions. However, the molecular link between
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service