Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU040951

Sigma-Aldrich

MISSION® esiRNA

targeting human CTSD, RP11-295K3.1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCGAGGTGCTCAAGAACTACATGGACGCCCAGTACTACGGGGAGATTGGCATCGGGACGCCCCCCCAGTGCTTCACAGTCGTCTTCGACACGGGCTCCTCCAACCTGTGGGTCCCCTCCATCCACTGCAAACTGCTGGACATCGCTTGCTGGATCCACCACAAGTACAACAGCGACAAGTCCAGCACCTACGTGAAGAATGGTACCTCGTTTGACATCCACTATGGCTCGGGCAGCCTCTCCGGGTACCTGAGCCAGGACACTGTGTCGGTGCCCTGCCAGTCAGCGTCGTCAGCCTCTGCCCTGGGCGGTGTCAAAGTGGAGAGGCAGGTCTTTGGGGAGGCCACCAAGCAGCCAGGCATCACCTTCATCGCAGCCAAGTTCGATGGCATCCTGGGCATGGCCTACCCCCGCATCTCCGTCAACAACGTGCTGCCCGTCTTCGACAACCTGATGCAGCAGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tung-Yi Lin et al.
International journal of molecular sciences, 21(17) (2020-08-28)
Poor prognosis due to the high relapse and metastasis rates of breast cancer has been particularly linked to the luminal B subtype. The current study utilized MCF-7 and ZR-75-1 to investigate various luminal subtypes of breast cancers that have discrepant
Lin Cui et al.
Frontiers in cell and developmental biology, 8, 31-31 (2020-03-03)
Lysosomal membrane permeabilization (LMP) has recently been recognized as an important cell death pathway in various cell types. However, studies regarding the correlation between LMP and cardiomyocyte death are scarce. Lysosomal membrane-associated protein 2 (Lamp2) is an important component of
C S F Oliveira et al.
Cell death & disease, 6, e1788-e1788 (2015-06-19)
Acetate is a short-chain fatty acid secreted by Propionibacteria from the human intestine, known to induce mitochondrial apoptotic death in colorectal cancer (CRC) cells. We previously established that acetate also induces lysosome membrane permeabilization in CRC cells, associated with release
Satoshi Kitazawa et al.
Cancer science, 108(6), 1185-1193 (2017-03-21)
Vacuolar (H
Morten P Oksvold et al.
Clinical therapeutics, 36(6), 847-862 (2014-06-24)
Exosomes are small (30- to 100-nm) vesicles secreted by all cell types in culture and found in most body fluids. A mean of 1 mL of blood serum, derived from healthy donors, contains approximately 10(12) exosomes. Depending on the disease

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico