Saltar al contenido
Merck

EHU011031

Sigma-Aldrich

MISSION® esiRNA

targeting human TLR7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAAGTTGGCTTCTGCTCAAATGCCAGAACTTCTGTAGAAAGTTATGAACCCCAGGTCCTGGAACAATTACATTATTTCAGATATGATAAGTATGCAAGGAGTTGCAGATTCAAAAACAAAGAGGCTTCTTTCATGTCTGTTAATGAAAGCTGCTACAAGTATGGGCAGACCTTGGATCTAAGTAAAAATAGTATATTTTTTGTCAAGTCCTCTGATTTTCAGCATCTTTCTTTCCTCAAATGCCTGAATCTGTCAGGAAATCTCATTAGCCAAACTCTTAATGGCAGTGAATTCCAACCTTTAGCAGAGCTGAGATATTTGGACTTCTCCAACAACCGGCTTGATTTACTCCATTCAACAGCATTTGAAGAGCTTCACAAACTGGAAGTTCTGGATATAAGCAGTAATAGCCATTATTTTCAATCAGAAGGAATTACTCATATGCTAAACTTTACCAAGAACCTAAAGGTTCTGCAGAAACTGATGATGAACGACAATGACATCTCTTCCTCCACCAGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yayi Huang et al.
Revista da Associacao Medica Brasileira (1992), 65(8), 1067-1073 (2019-09-19)
Diabetes is a risk factor for acute kidney injury (AKI). However, its mechanism of pathogenesis has not been elucidated. The aim of the study was to investigate the role of inflammation and the toll-like receptor 7 (TLR7) in ischemic AKI
Nuoyan Zheng et al.
JCI insight, 5(14) (2020-07-24)
TLR7 has been linked to the pathogenesis of glomerulonephritis, but its precise roles are not clear. In this study, we evaluated the roles of TLR7 in IgA nephropathy (IgAN). TLR7 proteins were abundant in CD19+ B cells infiltrated in the
Federica Liotti et al.
Cancers, 13(4) (2021-02-14)
Pattern recognition receptors (PRR) promote inflammation but also its resolution. We demonstrated that a specific PRR-formyl peptide receptor 1 (FPR1)-sustains an inflammation resolution response with anti-angiogenic and antitumor potential in gastric cancer. Since toll-like receptor 7 (TLR7) is crucial in
Yun-Ru Liao et al.
Biochemical and biophysical research communications, 493(2), 1136-1142 (2017-08-28)
Diabetic retinopathy (DR) is a major microvascular complication of diabetes, resulting in neuronal dysfunction, retinal vascular leakage, and apoptosis within the retina. Innate immunity plays an important role in the pathogenesis of type 2 diabetes (T2D) and related complications. The
Ryoichiro Nishibayashi et al.
PloS one, 10(6), e0129806-e0129806 (2015-06-18)
Interleukin-12 (IL-12) is an important cytokine for the immunomodulatory effects of lactic acid bacteria (LAB). Using murine immune cells, we previously reported that the RNA of Enterococcus faecalis EC-12, a LAB strain exerting probiotic-like beneficial effects, is the major IL-12-inducing

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico