Skip to Content
Merck
All Photos(1)

Key Documents

EHU113511

Sigma-Aldrich

MISSION® esiRNA

targeting human BAK1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACCGACGCTATGACTCAGAGTTCCAGACCATGTTGCAGCACCTGCAGCCCACGGCAGAGAATGCCTATGAGTACTTCACCAAGATTGCCACCAGCCTGTTTGAGAGTGGCATCAATTGGGGCCGTGTGGTGGCTCTTCTGGGCTTCGGCTACCGTCTGGCCCTACACGTCTACCAGCATGGCCTGACTGGCTTCCTAGGCCAGGTGACCCGCTTCGTGGTCGACTTCATGCTGCATCACTGCATTGCCCGGTGGATTGCACAGAGGGGTGGCTGGGTGGCAGCCCTGAACTTGGGCAATGGTCCCATCCTGAACGTGCTGGTGGTTCTGGGTGTGGTTCTGTTGGGCCAGTTTGTGGTACGAAGATTCTTCAAATCATGACTCCCAAGGGTGCCCTTTGGGGTCCCGGTTCAGACCCCTGCCTGGACTTAAGCGAAGTCTTTGCCTTCTCTGTTCCCTTGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shunnan Yao et al.
Cancer letters, 483, 87-97 (2020-04-09)
Hepatocellular carcinoma (HCC) is a common malignancy with a poor prognosis. Dimethylaminomicheliolide (DMAMCL) is a novel antitumor agent that has been tested in phase I clinical trials; however, little is known regarding its effects in HCC. In this study, we
Rong Zhang et al.
Cell death & disease, 9(6), 598-598 (2018-05-24)
Hirsutine extracted from Uncaria rhynchophylla has been shown to exhibit anti-cancer activity. However, the molecular mechanism by which hirsutine exhibits anti-lung cancer activity remains unclear. In the present study, we showed that hirsutine induces apoptosis in human lung cancer cells
Haiyan Tan et al.
Oncotarget, 6(36), 39184-39195 (2015-10-10)
Prostate cancer is the second most commonly diagnosed cancer among men in the United States. Prostate cancer therapy is severely hampered by lack of response and development of resistance to conventional chemotherapeutic drugs in patients. Therefore, the development and discovery
Chiaki Tsuge Ishida et al.
Oncotarget, 8(23), 37140-37153 (2017-04-19)
Malignant gliomas display high levels of the transcription factor c-myc and organize a tumor specific chaperone network within mitochondria. Here, we show that c-myc along with mitochondrial chaperone inhibition displays massive tumor cell death. Inhibition of mitochondrial matrix chaperones and
Melissa Desouza-Armstrong et al.
Cytoskeleton (Hoboken, N.J.), 74(6), 233-248 (2017-04-06)
The actin cytoskeleton is a polymer system that acts both as a sensor and mediator of apoptosis. Tropomyosins (Tpm) are a family of actin binding proteins that form co-polymers with actin and diversify actin filament function. Previous studies have shown

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service