Skip to Content
MilliporeSigma
All Photos(1)

Documents

EMU216481

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Vcan

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCATAGCAAGCCCAGAGCAGCTGTTTGCCGCCTATGAGGATGGATTTGAGCAGTGTGATGCAGGATGGCTGTCTGATCAAACTGTCAGATATCCCATACGGGCTCCCCGAGAGGGCTGTTACGGAGACATGATGGGGAAGGAAGGGGTTCGGACCTATGGATTCCGCTCTCCCCAGGAAACCTATGATGTGTATTGTTATGTGGATCATCTGGATGGCGATGTGTTCCACATCACTGCTCCCAGTAAGTTCACCTTCGAGGAGGCCGAAGCAGAGTGTACAAGCAGGGATGCGAGGCTGGCGACTGTTGGAGAACTTCAGGCAGCTTGGAGAAATGGCTTTGACCAATGCGATTACGGCTGGCTGTCGGATGCCAGCGTGCGGCACCCTGTGACTGTGGCCAGGGCCCAGTGTGGAGGAGGTCTACTTGGGGTGAGAACCCTGTATCGTTTTGAGAACCAGACATGCTTCCCTCTCCCTGATAGCAGATTTGATGCCTACTGCTTTAAA

Ensembl | mouse accession no.

ENSMUSG00000021614

NCBI accession no.

NM_019389

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... VCAN(13003) , Vcan(13003)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lu-lu Xu et al.
Respiratory physiology & neurobiology, 215, 58-63 (2015-05-23)
COPD lung is characterized by loss of alveolar elastic fibers and an increase in the chondroitin sulfate (CS) matrix proteoglycan versican V1 (V1). V1 is a known inhibitor of elastic fiber deposition and this study investigates the effects of knockdown
Zi Wang et al.
Oncology reports, 33(6), 2981-2991 (2015-04-16)
The systematic application of antiangiogenic therapy remains an issue of concern, mainly due to the hypoxic and inflammatory changes in the tumor microenvironment elicited by antiangiogenic therapy. Versican, a 'bridge' connecting inflammation with tumor progression as well as playing a
Jon M Carthy et al.
Cardiovascular pathology : the official journal of the Society for Cardiovascular Pathology, 24(6), 368-374 (2015-09-24)
Versican is a versatile and highly interactive chondroitin sulfate proteoglycan that is found in the extracellular matrix (ECM) of many tissues and is a major component of developing and developed lesions in atherosclerotic vascular disease. In this paper, we present
Pamela A Havre et al.
BMC cancer, 13, 517-517 (2013-11-05)
CD26/dipeptidyl peptidase IV (DPPIV) is a multifunctional membrane protein with a key role in T-cell biology and also serves as a marker of aggressive cancers, including T-cell malignancies. Versican expression was measured by real-time RT-PCR and Western blots. Gene silencing
Naoko Arichi et al.
Oncoscience, 2(2), 193-204 (2015-04-11)
In the current study, we investigated a combination of docetaxel and thalidomide (DT therapy) in castration-resistant prostate cancer (CRPC) patients. We identified marker genes that predict the effect of DT therapy. Using an androgen-insensitive PC3 cell line, we established a
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service