Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU089831

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sp7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTTTACCAGAAGCGACCACTTGAGCAAACATCAGCGCACCCACGGGGAGCCAGGCCCGGGACCGCCCCCAAGTGGCCCTAAGGAGCTGGGGGAGGGTCGCAGCGTCGGGGAAGAAGAAGCCAATCAGCCGCCCCGATCTTCCACTTCGCCTGCACCCCCAGAAAAAGCCCACGGAGGCAGCCCAGAGCAGAGCAACCTGCTAGAGATCTGAGCCGGGTAGAGGAAGGTCTCCAGCTCCAGGGTCCTCTTGCCAGGCTCTCTTGGCGTGCTGGACCCATTGGTTGCCCCTCGCTCTCTCCTATTGCATGCTATACTCTGGGGGCTCTCTCTGTTCCCCTAGGCTATCTCCTTGCATGTCTCCTCAGTTCTTCTCTCTTTGTCAAGAGTCTTAGCCAAACTCCTCTCAGGCCTTTGCCAGTGCCTAGTTCCTATGCTCCGACCTCCTCAACTTTTTCTTCTCTGCCCCTGTTCTTCACAGCTTCCATCTGGCCTCACATCATTTTCTCATTAACTCGTTGCCATCTAATCTTTCTGCTTCCCAATCCTATTTGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ning Li et al.
Molecular therapy. Nucleic acids, 22, 971-980 (2020-12-01)
Calcific aortic valve disease (CAVD) is a common heart valve disease in aging populations, and aberrant osteogenic differentiation of valvular interstitial cells (VICs) plays a critical role in the pathogenesis of ectopic ossification of the aortic valve. miR-214 has been
Wen-lin Xiao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 36(3), 1015-1025 (2015-06-27)
The relationship between the p38MAPK signaling pathway and osterix in osteogenic differentiation of BMMSCs subjected to intermittent stretching was investigated. BMMSCs derived from C57BL/6J mice were divided into the following groups: 1) control, 2) stretch, and 3) SB203580+stretch (SB203580 is
Y Zhang et al.
Oral diseases, 21(5), 583-592 (2015-02-05)
To understand the differences and similarities between immunocompetent and immunodeficient mice as ectopic transplantation animal models for bone tissue engineering. Osteogenic cells from mouse leg bones were cultured, seeded on β-TCP granules, and transplanted onto the backs of either immunocompetent

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service