Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU075291

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Myc

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCTCCACTCACCAGCACAACTACGCCGCACCCCCCTCCACAAGGAAGGACTATCCAGCTGCCAAGAGGGCCAAGTTGGACAGTGGCAGGGTCCTGAAGCAGATCAGCAACAACCGCAAGTGCTCCAGCCCCAGGTCCTCAGACACGGAGGAAAACGACAAGAGGCGGACACACAACGTCTTGGAACGTCAGAGGAGGAACGAGCTGAAGCGCAGCTTTTTTGCCCTGCGTGACCAGATCCCTGAATTGGAAAACAACGAAAAGGCCCCCAAGGTAGTGATCCTCAAAAAAGCCACCGCCTACATCCTGTCCATTCAAGCAGACGAGCACAAGCTCACCTCTGAAAAGGACTTATTGAGGAAACGACGAGAACAGTTGAAACACAAACTCGAACAGCTTCGAAACTCTGGTGCATAAACTGACCTAACTCGAGGAGGAGCTGGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Naveen K Tangudu et al.
Molecular cancer therapeutics, 14(5), 1259-1269 (2015-02-20)
In this article, we report the development and preclinical validation of combinatorial therapy for treatment of cancers using RNA interference (RNAi). RNAi technology is an attractive approach to silence genes responsible for disease onset and progression. Currently, the critical challenge
Wen-Li Mu et al.
Stem cells (Dayton, Ohio), 33(7), 2135-2147 (2015-05-06)
Mouse somatic cells can be reprogrammed into induced pluripotent stem cells by defined factors known to regulate pluripotency, including Oct4, Sox2, Klf4, and c-Myc. Together with Oct4, Sox2 plays a major role as a master endogenous pluripotent genes trigger in
C M Lucas et al.
Leukemia, 29(7), 1514-1523 (2015-03-15)
High cancerous inhibitor of PP2A (CIP2A) protein levels at diagnosis of chronic myeloid leukaemia (CML) are predictive of disease progression in imatinib-treated patients. It is not known whether this is true in patients treated with second generation tyrosine kinase inhibitors
Kazunori Hamamura et al.
Cellular signalling, 26(11), 2358-2369 (2014-07-20)
Wnt signaling plays a major role in bone homeostasis and mechanotransduction, but its role and regulatory mechanism in osteoclast development are not fully understood. Through genome-wide in silico analysis, we examined Wnt3a-driven regulation of osteoclast development. Mouse bone marrow-derived cells
David Kozono et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(30), E4055-E4064 (2015-07-15)
The available evidence suggests that the lethality of glioblastoma is driven by small subpopulations of cells that self-renew and exhibit tumorigenicity. It remains unclear whether tumorigenicity exists as a static property of a few cells or as a dynamically acquired

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service