Skip to Content
MilliporeSigma
All Photos(1)

Documents

EMU050451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Suz12

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGGCTCCTATGCAGGAAATCCTCAGGATATACATCGCCAACCTGGATTTGCTTTTAGTCGAAATGGACCGGTAAAGAGAACACCTATCACACATATTCTTGTTTGCAGGCCAAAAAGAACAAAAGCAAGCATGTCGGAGTTTCTTGAATCTGAAGATGGAGAAGTGGAGCAGCAGAGAACATACAGCAGTGGCCACAATCGTCTCTATTTCCACAGTGATACCTGCTTACCTCTTCGGCCACAAGAAATGGAAGTAGATAGTGAAGATGAGAAAGATCCAGAATGGCTGAGAGAAAAAACCATTACTCAAATTGAAGAATTTTCTGATGTGAATGAAGGAGAGAAAGAAGTGATGAAGCTGTGGAACCTCCATGTCATGAAGCATGGATTTATTGCTGACAATCAAATGAATCATGCCTGTATGCTGTTTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of
Ming-de Huang et al.
Journal of hematology & oncology, 8, 50-50 (2015-05-15)
Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related death, especially in China. And the mechanism of its progression remains poorly understood. Growing evidence indicates that long non-coding RNAs (lncRNAs) are found to be dysregulated in many cancers
Xuefei Shi et al.
Molecular carcinogenesis, 54 Suppl 1, E1-E12 (2013-12-21)
In more recent years, long non-coding RNAs (lncRNAs) have been investigated as a new class of regulators of cellular processes, such as cell growth, apoptosis, and carcinogenesis. Although lncRNAs are dysregulated in numerous cancer types, limited data are available on
Michael Anthony Ruiz et al.
PloS one, 10(4), e0123987-e0123987 (2015-04-18)
Glucose-induced augmented vascular endothelial growth factor (VEGF) production is a key event in diabetic retinopathy. We have previously demonstrated that downregulation of miR-200b increases VEGF, mediating structural and functional changes in the retina in diabetes. However, mechanisms regulating miR-200b in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service