Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU021131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Notch4

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGAAGGAAGCGACACGTACGAGTCTGGAAGACTCCGGACTTTTAAGGCCAAAATAACCGTTAAGCTCACTTGTCTCCCCCATAGAGTATGCACAGCAATGGGAAGAGGGTTTAGGATGTCCGGTTGAGATAGACCGTGATTTTCCTGGAAAATAGGGCAGCTTCAAGAGGACAAAGTTGATTTCGAGAATCCCTAAACTCTGGAACCAAGAACTGTGGGCGAATTGGGTGTAAAATGTTTCTTGAGTATGGTTTCCCAAAAGGAGCCTCTGCTATCTACTGCCCACAAGTAGCTGGCAACTATTTATTAAGCACCTACGATGTGCCGGGTGTTGTGTAGATGATGAACAGTAACCAGTGGCCCATCCAGCTGATGACTCCTTGCCCTCTCTCTGCCTCCCCACAAGGACACTGGTGCAGGGATGAGGCCATGTTCTCCAGT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cui-Juan Qian et al.
Oncology letters, 12(5), 3499-3505 (2016-12-03)
Overexpression of Notch4 is associated with a variety of tumor types. Only sparse information exists on Notch4 expression in pancreatic cancer (PC). The present study demonstrated that Notch4 expression was significantly upregulated in PC cell lines compared with a non-transformed
Quyen Thu Bui et al.
Cancer letters, 390, 115-125 (2017-01-22)
We previously demonstrated that tamoxifen (TAM)-resistant human breast cancer (TAMR-MCF-7) cells showed increased expression of mesenchymal marker proteins compared to the parent MCF-7 cells. Notch is functionally important in the promotion of epithelial-mesenchymal transition (EMT) during both development and tumor
Hebah A Sindi et al.
Nature communications, 11(1), 1185-1185 (2020-03-07)
Pulmonary arterial hypertension (PAH) is a severe disorder of lung vasculature that causes right heart failure. Homoeostatic effects of flow-activated transcription factor Krüppel-like factor 2 (KLF2) are compromised in PAH. Here, we show that KLF2-induced exosomal microRNAs, miR-181a-5p and miR-324-5p

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service