Skip to Content
MilliporeSigma
All Photos(1)

Documents

EMU013051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cav1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATCAGCACGCAGAAAGAGATATGAGGGACATTTCAAGGATGAAAGGTTTTTTCCCCCCTTACTATTTCCTTGGTGCCAATTCCAAGTTGCTCTCGCAGCAGCAAATTTATGAATGGTTTGTCTTGATCAAGAACAAAGAATTCATTCCCACCATTCTCATATATACTACTTGTCTCTTCTAAGCTACTGCATCTATGTTTGACAGTCTGGAATGTTTAAACCCATTCCTGCTCTCTCTTTTATATGTGAATCATTGTTTCATTGGCTAAAATATAAACATATTGTTGAAAGATGATTTGAGAAAAATAGGAAGGACTGGGAGGCAGGGAAGAGTACCAACAACCTCAACTGCCTACTCAAAGGTGATGATGTCATACAAAGGGAAGAGATTCAGGTTACGGCCATTTGTTTAGGGGCATGAAGG

Ensembl | mouse accession no.

ENSMUSG00000007655

NCBI accession no.

NP_031642

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... CAV1(12389) , Cav1(12389)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jing Zeng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(4), 1289-1300 (2015-10-03)
Pulmonary microvascular endothelial cell (PMVEC) proliferation and angiogenesis contribute to the development of hepatopulmonary syndrome (HPS). MicroRNA-199a-5p (miR-199a-5p) has emerged as a potent regulator of angiogenesis, and its expression levels significantly decrease in the serum of patients with hepatopathy. However
Carmen Juks et al.
Biochimica et biophysica acta, 1848(12), 3205-3216 (2015-09-27)
Cell penetrating peptides are efficient tools to deliver various bioactive cargos into cells, but their exact functioning mechanism is still debated. Recently, we showed that a delivery peptide PepFect14 condenses oligonucleotides (ON) into negatively charged nanocomplexes that are taken up
Fanrui Meng et al.
PloS one, 10(5), e0126056-e0126056 (2015-05-06)
Expression of Caveolin-1 (Cav1), a key component of cell surface caveolae, is elevated in prostate cancer (PCa) and associated with PCa metastasis and a poor prognosis for PCa patients. Polymerase I and Transcript Release Factor (PTRF)/cavin-1 is a cytoplasmic protein
Emily J Guggenheim et al.
Nanotoxicology, 14(4), 504-532 (2020-02-11)
Engineered Nanomaterials (NMs), such as Superparamagnetic Iron Oxide Nanoparticles (SPIONs), offer significant benefits in a wide range of applications, including cancer diagnostic and therapeutic strategies. However, the use of NMs in biomedicine raises safety concerns due to lack of knowledge
Q Chen et al.
Cellular and molecular biology (Noisy-le-Grand, France), 61(2), 33-38 (2015-05-31)
Bladder cancer occurs in the majority of cases in males, which represents the fourth highest incident cancer in men and tenth in women. It is associated with a high rate of recurrence, and prognosis is poor once the cancer metastasizes
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service