Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU157081

Sigma-Aldrich

MISSION® esiRNA

targeting human NFATC2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACCACCACCAGCTATGAGAAGATAGTGGGCAACACCAAAGTCCTGGAGATACCCTTGGAGCCCAAAAACAACATGAGGGCAACCATCGACTGTGCGGGGATCTTGAAGCTTAGAAACGCCGACATTGAGCTGCGGAAAGGCGAGACGGACATTGGAAGAAAGAACACGCGGGTGAGACTGGTTTTCCGAGTTCACATCCCAGAGTCCAGTGGCAGAATCGTCTCTTTACAGACTGCATCTAACCCCATCGAGTGCTCCCAGCGATCTGCTCACGAGCTGCCCATGGTTGAAAGACAAGACACAGACAGCTGCCTGGTCTATGGCGGCCAGCAAATGATCCTCACGGGGCAGAACTTTACATCCGAGTCCAAAGTTGTGTTTACTGAGAAGACCACAGATGGACAGCAAATTTGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Joyce V Lee et al.
Genes & development, 32(7-8), 497-511 (2018-04-21)
The metabolite acetyl-coenzyme A (acetyl-CoA) is the required acetyl donor for lysine acetylation and thereby links metabolism, signaling, and epigenetics. Nutrient availability alters acetyl-CoA levels in cancer cells, correlating with changes in global histone acetylation and gene expression. However, the
Jasper Wouters et al.
Nature cell biology, 22(8), 986-998 (2020-08-06)
Melanoma cells can switch between a melanocytic and a mesenchymal-like state. Scattered evidence indicates that additional intermediate state(s) may exist. Here, to search for such states and decipher their underlying gene regulatory network (GRN), we studied 10 melanoma cultures using
Yanjiao Huang et al.
Experimental and therapeutic medicine, 20(2), 736-747 (2020-08-04)
Store-operated Ca2+ entry (SOCE) is the stable calcium channel influx in most cells. It consists of the cytoplasmic ion channel ORAI and endoplasmic reticulum receptor stromal interaction molecule 1 (STIM1). Abolition of SOCE function due to ORAI1 and STIM1 gene
Christina Springstead Scanlon et al.
Nature communications, 6, 6885-6885 (2015-04-29)
Perineural invasion (PNI) is an indicator of poor survival in multiple cancers. Unfortunately, there is no targeted treatment for PNI since the molecular mechanisms are largely unknown. PNI is an active process, suggesting that cancer cells communicate with nerves. However

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service