Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU079401

Sigma-Aldrich

MISSION® esiRNA

targeting human TREM2

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$220.00
50 μG
$391.00

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGTTCAAGGGAAAGACGAGATCTTGCACAAGGCACTCTGCTTCTGCCCTTGGCTGGGGAAGGGTGGCATGGAGCCTCTCCGGCTGCTCATCTTACTCTTTGTCACAGAGCTGTCCGGAGCCCACAACACCACAGTGTTCCAGGGCGTGGCGGGCCAGTCCCTGCAGGTGTCTTGCCCCTATGACTCCATGAAGCACTGGGGGAGGCGCAAGGCCTGGTGCCGCCAGCTGGGAGAGAAGGGCCCATGCCAGCGTGTGGTCAGCACGCACAACTTGTGGCTGCTGTCCTTCCTGAGGAGGTGGAATGGGAGCACAGCCATCACAGACGATACCCTGGGTGGCACTCTCACCATTACGCTGCGGAATCTACAACCCCATGATGCGGGTCTCTACCAGTGCCAGAGCCTCCATGGCAGTGAGGCTGACACCCTCAGGAAGGTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiao-Yan Wang et al.
Biochemical and biophysical research communications, 532(3), 329-335 (2020-09-27)
Drug resistance remains the unresolved obstacle for gastric cancer (GC) treatment. Recently more and more studies have shown that microRNAs are involved in cancer resistance and could apply to drug resistance therapy in tumors. The relationship between miR-149 and 5-fluorouracil
Teng Jiang et al.
Neurobiology of aging, 36(12), 3176-3186 (2015-09-15)
Tau pathology is a pathological hallmark for several neurodegenerative diseases including Alzheimer's disease and frontotemporal dementia. As a novel susceptibility gene for these 2 diseases, triggering receptor expressed on myeloid cells 2 (TREM2) gene encodes an immune receptor that is
Shengpan Chen et al.
Journal of neuroinflammation, 17(1), 168-168 (2020-05-30)
Neuroinflammation is an important host defense response to secondary brain injury after intracerebral hemorrhage (ICH). Triggering receptor expressed on myeloid cells 2 (TREM2) confers strong neuroprotective effects by attenuating neuroinflammation in experimental ischemic stroke. Recent studies suggest that apolipoprotein E
Saini Yi et al.
Cytotechnology, 72(4), 589-602 (2020-07-06)
Triggering receptor expressed on myeloid cells-2 (TREM2) is an innate immune receptor that promotes phagocytosis by microglia. However, whether TREM2 is related to the stimulus-dependent phagocytic activity of microglia is unclear. In this study, the primary cultured microglia were stimulated
Rumana Akhter et al.
Molecular immunology, 131, 171-179 (2021-01-20)
Alzheimer's disease (AD) is characterized by the accumulation in the brain of extracellular amyloid β (Aβ) plaques as well as intraneuronal inclusions (neurofibrillary tangles) consisting of total tau and phosphorylated tau. Also present are dystrophic neurites, loss of synapses, neuronal

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service