Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU072661

Sigma-Aldrich

MISSION® esiRNA

targeting human MLKL

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGACACATCCCACTCCAAATGATATTTCCAAAAACATACCTCTGACAGTAACTTTGATAGATGGTTTGTCAAATGTATCTTTCTGGGTATCCACACCTCTTGGCAATGAAATTTGCAGCTCCTCCCTTCCATAAATGAAGTCTCTTTCCCCACCATTTGAATCTGGGCTGGCACTGTGACTTGATTTGATCAATAGAATGTGGAAGAAGTGACTGTATGCCAGTTCCAAGCCTAGGTTTCAAGAGGCCTTATAAATGTCTGTTGGAACCTTACCCAGCCATGAACATGTTGAGTGAGCATGCTGGAGAATGAGAGACCACATGAAGCAGAAACATGCTTTCCTAGCTGAAGTCATACTAGCCCAACCAACATGGCAGCTAACACATGAATGAGGCCAATCAAGACCAG

Ensembl | human accession no.

ENSG00000168404

NCBI accession no.

NM_152649

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MLKL(197259) , MLKL(197259)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Piotr T Filipczak et al.
Cancer research, 76(24), 7130-7139 (2016-10-21)
Tuberous sclerosis complex (TSC) is a genetic multiorgan disorder characterized by the development of neoplastic lesions in kidney, lung, brain, heart, and skin. It is caused by an inactivating mutation in tumor suppressor genes coding the TSC1/TSC2 complex, resulting in
Yu Xiong et al.
Cell death and differentiation, 26(10), 1929-1941 (2019-01-16)
Necroptosis is a programmed form of necrotic cell death, which is tightly regulated by the necroptotic signaling pathway containing receptor-interacting protein (RIP)1, RIP3, and mixed-lineage kinase domain-like (MLKL) protein. In addition to the RIP1-RIP3-MLKL axis, other factors regulating necroptosis are
Chengkui Yang et al.
Cell death & disease, 8(10), e3084-e3084 (2017-10-06)
Receptor-interacting kinase-3 (RIP3) is a key regulator of necroptosis. It has been shown that the expression of RIP3 is silenced in most cancer cells and tissues due to genomic methylation. However, the regulatory mechanisms controlling RIP3 expression in cancer cells
Yu Matsuzawa-Ishimoto et al.
The Journal of experimental medicine, 214(12), 3687-3705 (2017-11-02)
A variant of the autophagy gene
R S Al-Lamki et al.
Cell death & disease, 7(6), e2287-e2287 (2016-07-01)
We previously reported that renal clear cell carcinoma cells (RCC) express both tumor necrosis factor receptor (TNFR)-1 and -2, but that, in organ culture, a TNF mutein that only engages TNFR1, but not TNFR2, causes extensive cell death. Some RCC
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service