Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU060231

Sigma-Aldrich

MISSION® esiRNA

targeting human FAS

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCAAGTTGCTGAATCAATGGAGCCCTCCCCAACCCGGGCGTTCCCCAGCGAGGCTTCCTTCCCATCCTCCTGACCACCGGGGCTTTTCGTGAGCTCGTCTCTGATCTCGCGCAAGAGTGACACACAGGTGTTCAAAGACGCTTCTGGGGAGTGAGGGAAGCGGTTTACGAGTGACTTGGCTGGAGCCTCAGGGGCGGGCACTGGCACGGAACACACCCTGAGGCCAGCCCTGGCTGCCCAGGCGGAGCTGCCTCTTCTCCCGCGGGTTGGTGGACCCGCTCAGTACGGAGTTGGGGAAGCTCTTTCACTTCGGAGGATTGCTCAACAACCATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTATCGTCCAAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACTGTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FAS(355) , FAS(355)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Neetu Singh et al.
European journal of pharmacology, 815, 462-469 (2017-10-05)
Endothelial dysfunction plays an important role in structural remodeling occurring in the pulmonary vasculature during pulmonary hypertension (PH). Endothelial injury causes apoptosis and activation of endothelial cells. However, some endothelial cells show apoptosis-resistance and later proliferate extensively leading to vascular
Chen-Ting Lee et al.
Radiation research, 188(2), 169-180 (2017-06-10)
Breast cancer is the most common malignancy diagnosed among women and represents a heterogeneous group of subtypes. Radiation therapy is a critical component of treatment for breast cancer patients. However, little is known about radiation response among these intrinsic subtypes.
Sara Cuadrado-Castano et al.
Molecular cancer therapeutics, 14(5), 1247-1258 (2015-03-13)
Newcastle disease virus (NDV) is considered a promising agent for cancer therapy due to its oncolytic properties. These include preferential replication in transformed cells, induction of innate and adaptive immune responses within tumors, and cytopathic effects in infected tumor cells
K Mizrahi et al.
Bone marrow transplantation, 49(7), 942-949 (2014-04-30)
The influence of TNF-α and Fas-ligand (FasL) on viability and function was evaluated in fresh- and expanded-umbilical cord blood (UCB) cells. CD34(+) progenitors and T cells display outstanding survival, whereas ~30% and >50% B lymphocytes and myeloid cells undergo spontaneous
Janet K Horton et al.
Radiation research, 184(5), 456-469 (2015-10-22)
Although a standardized approach to radiotherapy has been used to treat breast cancer, regardless of subtype (e.g., luminal, basal), recent clinical data suggest that radiation response may vary significantly among subtypes. We hypothesized that this clinical variability may be due

Articles

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service