Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU048861

Sigma-Aldrich

MISSION® esiRNA

targeting human PALB2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTGCCAAGCAGAAGAAAGAAGCAGCAGAAGAGGACATTTATTTCACAGGAGAGAGACTGTGTCTTTGGCACTGATTCACTCAGATTGTCTGGGAAAAGACTAAAGGAACAGGAAGAAATCAGTAGCAAAAATCCTGCTAGATCACCAGTAACTGAAATAAGAACTCACCTTTTAAGTCTTAAATCTGAACTTCCAGATTCTCCAGAACCAGTTACAGAAATTAATGAAGACAGTGTATTAATTCCACCAACTGCCCAACCAGAAAAAGGTGTTGATACATTCCTAAGAAGACCTAATTTCACCAGGGCGACTACAGTTCCTTTACAGACTCTATCAGATAGCGGTAGTAGTCAGCACCTTGAACACATTCCTCCTAAAGGTAGCAGTGAACTTACTACTCACGACCTAAAAAACATTAGATTTACTTCACCTGTAAGTTTGGAGGCACAAGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ouyang Ge et al.
Oncology letters, 21(3), 224-224 (2021-02-23)
During DNA repair, BRCA1 and BRCA2 interact with the tumor suppressor partner and localizer of BRCA2 (PALB2). PALB2 mutations are associated with an increased risk of breast and ovarian carcinoma, and upregulated PALB2 expression is associated with poor clinical outcomes.
Antonis C Antoniou et al.
The New England journal of medicine, 371(6), 497-506 (2014-08-08)
Germline loss-of-function mutations in PALB2 are known to confer a predisposition to breast cancer. However, the lifetime risk of breast cancer that is conferred by such mutations remains unknown. We analyzed the risk of breast cancer among 362 members of
Joris Pauty et al.
Nucleic acids research, 45(5), 2644-2657 (2017-02-06)
One typical mechanism to promote genomic instability, a hallmark of cancer, is to inactivate tumor suppressors, such as PALB2. It has recently been reported that mutations in PALB2 increase the risk of breast cancer by 8-9-fold by age 40 and
Anar K Murphy et al.
The Journal of cell biology, 206(4), 493-507 (2014-08-13)
Phosphorylation of replication protein A (RPA) by Cdk2 and the checkpoint kinase ATR (ATM and Rad3 related) during replication fork stalling stabilizes the replisome, but how these modifications safeguard the fork is not understood. To address this question, we used

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service