Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU017501

Sigma-Aldrich

MISSION® esiRNA

targeting human CLDN1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCAGATCCAGTGCAAAGTCTTTGACTCCTTGCTGAATCTGAGCAGCACATTGCAAGCAACCCGTGCCTTGATGGTGGTTGGCATCCTCCTGGGAGTGATAGCAATCTTTGTGGCCACCGTTGGCATGAAGTGTATGAAGTGCTTGGAAGACGATGAGGTGCAGAAGATGAGGATGGCTGTCATTGGGGGTGCGATATTTCTTCTTGCAGGTCTGGCTATTTTAGTTGCCACAGCATGGTATGGCAATAGAATCGTTCAAGAATTCTATGACCCTATGACCCCAGTCAATGCCAGGTACGAATTTGGTCAGGCTCTCTTCACTGGCTGGGCTGCTGCTTCTCTCTGCCTTCTGGGAGGTGCCCTACTTTGCTGTTCCTGTCCCCGAAAAACAACCTCTTACCCAACACCAAGGCCCTATCCAAAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Trevor R Leonardo et al.
International journal of molecular sciences, 21(8) (2020-04-29)
Bicellular tight junctions are multiprotein complexes that are required for maintenance of barrier function and fence function in epithelial tissues. Wound healing in the oral cavity leads to minimal scar formation compared to the skin, and the precise mechanisms for
Francescopaolo Di Cello et al.
PloS one, 8(7), e68630-e68630 (2013-07-12)
Downregulation of the tight junction protein claudin 1 is a frequent event in breast cancer and is associated with recurrence, metastasis, and reduced survival, suggesting a tumor suppressor role for this protein. Tumor suppressor genes are often epigenetically silenced in
Yi-Feng Zheng et al.
Journal of cellular biochemistry, 120(4), 6090-6105 (2018-12-07)
Colorectal carcinoma (CRC) is a major cause of cancer-related deaths worldwide, and investigations on novel targets are imperative. MiR-98 has been reported to act as a tumor suppressor in several cancers. To evaluate miR-98 as a novel anticancer molecule for
Jin Zhu et al.
Journal of translational medicine, 14(1), 166-166 (2016-06-10)
MicroRNAs have the potential as diagnostic biomarkers and therapeutic targets in autoimmune diseases. However, very limited studies have evaluated the expression of microRNA profile in thyroid gland related to Hashimoto's thyroiditis (HT). MicroRNA microarray expression profiling was performed and validated
Haruka Nasako et al.
International journal of molecular sciences, 21(16) (2020-08-23)
Claudin-1 (CLDN1), a tight junctional protein, is highly expressed in lung cancer cells and may contribute to chemoresistance. A drug which decreases CLDN1 expression could be a chemosensitizer for enhancing the efficacy of anticancer drugs, but there is no such

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service