Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU123481

Sigma-Aldrich

MISSION® esiRNA

targeting human RTN4

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCAGGAATGACAAAGCTTGCTTTTCTGGTATGTTCTAGGTGTATTGTGACTTTTACTGTTATATTAATTGCCAATATAAGTAAATATAGATTATATATGTATAGTGTTTCACAAAGCTTAGACCTTTACCTTCCAGCCACCCCACAGTGCTTGATATTTCAGAGTCAGTCATTGGTTATACATGTGTAGTTCCAAAGCACATAAGCTAGAAGAAGAAATATTTCTAGGAGCACTACCATCTGTTTTCAACATGAAATGCCACACACATAGAACTCCAACATCAATTTCATTGCACAGACTGACTGTAGTTAATTTTGTCACAGAATCTATGGACTGAATCTAATGCTTCCAAAAATGTTGTTTGTTTGCAAATATCAAACATTGTTATGCAAGAAATTATTAATTACAAAATGAAGATTTATACCATTGTGGTTTAAGCTGTACTG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000115310

numer dostępu NCBI

NM_007008

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... RTN4(57142) , RTN4(57142)

Powiązane kategorie

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yu-Jie Chen et al.
The Journal of cell biology, 219(2) (2020-01-03)
Escape of large macromolecular complexes from the endoplasmic reticulum (ER), such as a viral particle or cellular aggregate, likely induces mechanical stress initiated on the luminal side of the ER membrane, which may threaten its integrity. How the ER responds
Jin-Kyu Park et al.
Hepatology (Baltimore, Md.), 65(5), 1720-1734 (2017-01-17)
Nogo-B (Reticulon 4B) is an endoplasmic reticulum (ER) resident protein that regulates ER structure and function. Because ER stress is known to induce M2 macrophage polarization, we examined whether Nogo-B regulates M1/M2 polarization of Kupffer cells and alters the pathogenesis
Jiajia Cui et al.
Journal of controlled release : official journal of the Controlled Release Society, 304, 259-267 (2019-05-06)
Degradable poly(amine-co-ester) (PACE) terpolymers hold tremendous promise for siRNA delivery because these materials can be formulated into delivery vehicles with highly efficient siRNA encapsulation, providing effective knockdown with low toxicity. Here, we demonstrate that PACE nanoparticles (NPs) provide substantial protein
Dae-Gyun Ahn et al.
Cell cycle (Georgetown, Tex.), 14(14), 2301-2310 (2015-05-07)
Dysregulation of Ras signaling is the major cause of various cancers. Aberrant Ras signaling, however, provides a favorable environment for many viruses, making them suitable candidates as cancer-killing therapeutic agents. Susceptibility of cancer cells to such viruses is mainly due

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej