Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU108271

Sigma-Aldrich

MISSION® esiRNA

targeting human BRD7

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCAAGTGATTTCAGCATCCATGAGTTTTTGGCCACGTGCCAAGATTATCCGTATGTCATGGCAGATAGTTTACTGGATGTTTTAACAAAAGGAGGGCATTCCAGGACCCTACAAGAGATGGAGATGTCATTGCCTGAAGATGAAGGCCATACTAGGACACTTGACACAGCAAAAGAAATGGAGATTACAGAAGTAGAGCCACCAGGGCGTTTGGACTCCAGTACTCAAGACAGGCTCATAGCGCTGAAAGCAGTAACAAATTTTGGCGTTCCAGTTGAAGTTTTTGACTCTGAAGAAGCTGAAATATTCCAGAAGAAACTTGATGAGACCACCAGATTGCTCAGGGAACTCCAGGAAGCCCAGAATGAACGTTTGAGCACCAGACCCCCTCCGAACATGATCTGTCTCTTGGGTCCC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000166164

numer dostępu NCBI

NM_013263

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... BRD7(29117) , BRD7(29117)

Powiązane kategorie

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xiao-Meng Wang et al.
Journal of cellular and molecular medicine, 21(6), 1094-1105 (2016-12-14)
Bromodomain-containing protein 7 (BRD7) is a tumour suppressor that is known to regulate many pathological processes including cell growth, apoptosis and cell cycle. Endoplasmic reticulum (ER) stress-induced apoptosis plays a key role in diabetic cardiomyopathy (DCM). However, the molecular mechanism
Lena Golick et al.
Cellular and molecular life sciences : CMLS, 75(10), 1857-1869 (2017-11-12)
Reduced hepatic expression levels of bromodomain-containing protein 7 (BRD7) have been suggested to play a role in the development of glucose intolerance in obesity. However, the molecular mechanism by which BRD7 regulates glucose metabolism has remained unclear. Here, we show
Weihong Niu et al.
Journal of experimental & clinical cancer research : CR, 39(1), 30-30 (2020-02-08)
BRD7 is a tumor suppressor known to inhibit cell proliferation and cell cycle progression and initiate apoptosis in breast cancer. However, the function and underlying molecular events of BRD7 in tumor invasion and metastasis in breast cancer are not fully
Zili Zhang et al.
Redox biology, 36, 101619-101619 (2020-08-31)
Ferroptosis is a recently discovered form of programmed cell death, but its regulatory mechanisms are not fully understood. In the current study, we reported that the BRD7-P53-SLC25A28 axis played a crucial role in regulating ferroptosis in hepatic stellate cells (HSCs).

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej