Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU106961

Sigma-Aldrich

MISSION® esiRNA

targeting human FKBP1A

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAGAAGGGGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTCTAAAACTGGAATGACAGGAATGGCCTCCTCCCTTAGCTCCCTGTTCTTGGATCTGCCATGGAGGGATCTGGTGCCTCCAGACATGTGCACATGAATCCATATGGAGCTTTTCCTGATGTTCCACTCCACTTTGTATAGACATCTGCCCTGACTGAATGTGTTCTGTCACTCAGCTTTGCTTCCGACACCTCTGTTTC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000088832

numer dostępu NCBI

NM_000801

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... FKBP1A(2280) , FKBP1A(2280)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Mingyou Xing et al.
Cancer chemotherapy and pharmacology, 84(4), 861-872 (2019-08-21)
FK506-binding protein 12 (FKBP12) is abundant, ubiquitously expressed cytoplasmic protein with multiple functions in cell signaling transduction. Recently, we reported a novel function for FKBP12 in oncoprotein mouse double minute 2 (MDM2) self-ubiquitination and degradation, which greatly enhanced the sensitivity
Zicheng Wang et al.
Journal of cell science, 132(10) (2019-04-28)
Necroptosis is a regulated form of necrotic cell death that is mediated by receptor-interacting serine/threonine-protein kinase 1 (RIPK1), RIPK3 and mixed-lineage kinase domain-like protein (MLKL), which mediates necroptotic signal transduction induced by tumor necrosis factor (TNF). Although many target proteins
Itziar M D Posada et al.
Oncotarget, 8(27), 44550-44566 (2017-06-01)
Currently several combination treatments of mTor- and Ras-pathway inhibitors are being tested in cancer therapy. While multiple feedback loops render these central signaling pathways robust, they complicate drug targeting.Here, we describe a novel H-ras specific feedback, which leads to an
Tanner Stokes et al.
Cell reports, 32(5), 107980-107980 (2020-08-07)
Loading of skeletal muscle changes the tissue phenotype reflecting altered metabolic and functional demands. In humans, heterogeneous adaptation to loading complicates the identification of the underpinning molecular regulators. A within-person differential loading and analysis strategy reduces heterogeneity for changes in

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej