Wszystkie zdjęcia(1)

Dokumenty

Świadectwo pochodzenia/Certyfikat analizy (COA)

EHU094011

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human ITPR1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych

Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:

41105324

NACRES:

NA.51

opis

linia produktu

MISSION^®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGCTGACCTGAGGAGTGAGAAGCAGAAGAAGGAAGAGATCTTGAAGACCACGTGCTTTATCTGTGGCTTGGAAAGAGACAAGTTTGACAACAAGACTGTCACCTTTGAAGAGCACATCAAGGAAGAACACAACATGTGGCACTATCTGTGCTTCATCGTCCTGGTGAAAGTAAAGGACTCCACCGAATATACTGGGCCTGAGAGTTACGTGGCAGAAATGATCAAGGAAAGAAACCTTGACTGGTTCCCCAGGATGAGAGCCATGTCATTGGTCAGCAGTGATTCTGAAGGAGAACAGAATGAGCTGAGAAACCTGCAGGAGAAGCTGGAGTCCACCATGAAACTTGTCACGAACCTTTCTGGCCAGCTGTCGGAATTAAAGGATCAGATGACAGAACAAAGGAAGCAGAAACAAAGAATTGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000150995

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... ITPR1(3708) , ITPR1(3708)

Powiązane kategorie

MISSION® esiRNA

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Src-mediated Tyr353 phosphorylation of IP3R1 promotes its stability and causes apoptosis in palmitic acid-treated hepatocytes.

Ting Yu et al.

Experimental cell research, 399(2), 112438-112438 (2020-12-29)

Palmitic acid (PA)-induced hepatocyte apoptosis is critical for the progression of nonalcoholic fatty liver disease (NAFLD). Inositol 1,4,5-trisphosphate receptor type 1 (IP3R1) is an intracellular Ca2+-release channel and is involved in PA-induced hepatocyte apoptosis. While the expression of IP3R1 is

Cell micropatterning reveals the modulatory effect of cell shape on proliferation through intracellular calcium transients.

Jie Tong et al.

Biochimica et biophysica acta, 1864(12), 2389-2401 (2017-10-01)

The mechanism by which cell shape regulates the function of the cell is one of the most important biological issues, but it remains unclear. Here, we investigated the effect of the regulation of cell shape on proliferation by using a

Targeting mitochondria-associated membranes as a potential therapy against endothelial injury induced by hypoxia.

Yi-Dong Yang et al.

Journal of cellular biochemistry, 120(11), 18967-18978 (2019-06-27)

Mitochondrial dysfunction plays a principal role in hypoxia-induced endothelial injury, which is involved in hypoxic pulmonary hypertension and ischemic cardiovascular diseases. Recent studies have identified mitochondria-associated membranes (MAMs) that modulate mitochondrial function under a variety of pathophysiological conditions such as high-fat diet-mediated

PLCγ1-PKCε-IP3R1 signaling plays an important role in hypoxia-induced calcium response in pulmonary artery smooth muscle cells.

Vishal R Yadav et al.

American journal of physiology. Lung cellular and molecular physiology, 314(5), L724-L735 (2018-02-02)

Hypoxia-induced pulmonary vasoconstriction (HPV) is attributed to an increase in intracellular Ca2+ concentration ([Ca2+]i) in pulmonary artery smooth muscle cells (PASMCs). We have reported that phospholipase C-γ1 (PLCγ1) plays a significant role in the hypoxia-induced increase in [Ca2+]i in PASMCs

Ca2+ Release by IP3 Receptors Is Required to Orient the Mitotic Spindle.

Raul Lagos-Cabré et al.

Cell reports, 33(11), 108483-108483 (2020-12-17)

The mitotic spindle distributes chromosomes evenly to daughter cells during mitosis. The orientation of the spindle, guided by internal and external cues, determines the axis of cell division and thereby contributes to tissue morphogenesis. Progression through mitosis requires local Ca2+

Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej