Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU045551

Sigma-Aldrich

MISSION® esiRNA

targeting human STK39

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCCACCCAATGCTAATGAAGACTACAGAGAAGCTTCTTCTTGTGCCGTGAACCTCGTTTTGAGATTAAGAAACTCCAGAAAGGAACTTAATGACATACGATTTGAGTTTACTCCAGGAAGAGATACAGCAGATGGTGTATCTCAGGAGCTCTTCTCTGCTGGCTTGGTGGATGGTCACGATGTAGTTATAGTGGCTGCTAATTTACAGAAGATTGTAGATGATCCCAAAGCTTTAAAAACATTGACATTTAAGTTGGCTTCTGGCTGTGATGGGTCGGAGATTCCTGATGAAGTGAAGCTGATTGGGTTTGCTCAGTTGAGTGTCAGCTGATGTATGTCCCTTGATGTCACCCTGATCTGTCATGCCCCACCGCCACCCCTACTCCCTTCAACCCTCCCTCTTTC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000198648

numer dostępu NCBI

NM_013233

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... STK39(27347) , STK39(27347)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Ye Bi et al.
Frontiers in physiology, 11, 638-638 (2020-07-28)
SPS1-related proline/alanine-rich kinase (SPAK) plays important roles in regulating the function of numerous ion channels and transporters. With-no-lysine (WNK) kinase phosphorylates SPAK kinase to active the SPAK signaling pathway. Our previous studies indicated that WNK kinases regulate the activity of
Chih-Hao Shen et al.
BMC pulmonary medicine, 21(1), 58-58 (2021-02-17)
Hyperoxia downregulates the tight junction (TJ) proteins of the alveolar epithelium and leads to barrier dysfunction. Previous study has showed that STE20/SPS1-related proline/alanine-rich kinase (SPAK) interferes with the intestinal barrier function in mice. The aim of the present study is
Ken Yamada et al.
ACS chemical biology, 11(12), 3338-3346 (2016-10-08)
Protein kinases are known for their highly conserved adenosine triphosphate (ATP)-binding site, rendering the discovery of selective inhibitors a major challenge. In theory, allosteric inhibitors can achieve high selectivity by targeting less conserved regions of the kinases, often with an
Xiuyan Feng et al.
American journal of physiology. Renal physiology, 308(10), F1119-F1127 (2015-03-13)
Thiazide-sensitive sodium chloride cotransporter (NCC) plays an important role in maintaining blood pressure. Aldosterone is known to modulate NCC abundance. Previous studies reported that dietary salts modulated NCC abundance through either WNK4 [with no lysine (k) kinase 4]-SPAK (Ste20-related proline

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej