Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU044501

Sigma-Aldrich

MISSION® esiRNA

targeting human TP53INP1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGGGCCAACTAAAGACAAGGTTTTGAAATCTCAGCTATAAAAGACATCCAGCCAAACTCTCAGTCTTGCCTTAACAATGTTCCAGAGGCTGAATAAAATGTTTGTGGGTGAAGTCAGTTCTTCCTCCAACCAAGAACCAGAATTCAATGAGAAAGAAGATGATGAATGGATTCTTGTTGACTTCATAGATACTTGCACTGGTTTCTCAGCAGAAGAAGAAGAAGAAGAGGAGGACATCAGTGAAGAGTCACCTACTGAGCACCCTTCAGTCTTTTCCTGTTTACCGGCATCTCTTGAGTGCTTGGCTGATACAAGTGATTCCTGCTTTCTCCAGTTTGAGTCATGTCCAATGGAGGAGAGCTGGTTTATCACCCCACCCCCATGTTTTACTGCAGGTGGATTAACCACTATCAAGGTGGAAACAAGTCCTATGGAAAACCTTCTCATTGAACATCCCAGCA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Mingming Zhu et al.
Cancer medicine, 9(22), 8639-8649 (2020-09-29)
Recently, long noncoding RNAs (lncRNAs) were recognized as significant therapeutic targets in tumors. Our previous microarray analysis showed that lncRNA TCONS_000026334 expression was reduced in metastatic colorectal cancer (CRC) tissues. The objective of this study was to research the biological
Yonggang Huang et al.
Journal of Cancer, 11(22), 6545-6555 (2020-10-14)
Liver tumor-initiating cells (T-ICs) contribute to tumorigenesis, progression, recurrence and drug resistance of hepatocellular carcinoma (HCC). However, the underlying mechanism for the propagation of liver T-ICs remains unclear. In the present study, our finding shows that miR-96 is upregulated in
Xiaohuan Xia et al.
Stem cell research & therapy, 10(1), 282-282 (2019-09-25)
Recent studies suggested that miR-17~106 family was involved in the regulation of neural stem/progenitor cells (NPCs). However, distinct function of each family member was reported in regulating stem cells within and without the brain. Hence, to investigate the roles of

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej