Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

Wyświetl całą dokumentację

EHU018281

Sigma-Aldrich

MISSION® esiRNA

targeting human TXNRD1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACAAGCCCTGCAAGACTCTCGAAATTATGGATGGAAAGTCGAGGAGACAGTTAAGCATGATTGGGACAGAATGATAGAAGCTGTACAGAATCACATTGGCTCTTTGAATTGGGGCTACCGAGTAGCTCTGCGGGAGAAAAAAGTCGTCTATGAGAATGCTTATGGGCAATTTATTGGTCCTCACAGGATTAAGGCAACAAATAATAAAGGCAAAGAAAAAATTTATTCAGCAGAGAGATTTCTCATTGCCACTGGTGAAAGACCACGTTACTTGGGCATCCCTGGTGACAAAGAATACTGCATCAGCAGTGATGATCTTTTCTCCTTGCCTTACTGCCCGGGTAAGACCCTGGTTGTTGGAGCATCCTATGTCGCTTTGGAGTGCGCTGGATTTCTTGCTGGTATTGGTTTAGACGTCACTGTTATGGTTAGGTCCATTCTTCTTAGAGGATTTGACCAGGACATGGCCAACAAAATTGGTGAACACATGGAAGAACATGGCA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000198431

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... TXNRD1(7296) , TXNRD1(7296)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
QET
QCS
RSR

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Bin Zhu et al.
Biochemical pharmacology, 170, 113642-113642 (2019-09-22)
Lung cancer, similar to other chronic diseases, occurs due to perturbations in multiple signaling pathways. Mono-targeted therapies are not ideal since they are not likely to be effective for the treatment and prevention of lung cancer, and are often associated
Yichong Wang et al.
Oncology reports, 37(5), 2905-2912 (2017-04-14)
Aberrant neovascularization supports nutrients and the oxygen microenvironment in tumour growth, invasion and metastasis. Recapitulation of functional microvascular structures in vitro could provide a platform for the study of vascular conditions. Sulforaphane (SFN), an isothiocyanate, has been reported to possess chemopreventive
Chuncheng Hao et al.
Oncology letters, 13(4), 2071-2078 (2017-04-30)
Radiation treatment remains one of the major modalities in the treatment of lung cancer. Although the majority of patients initially respond to treatment with radiation, resistance inevitably develops and leads to treatment failure. Therefore, the identification of the underlying molecular
Xinzhi Wang et al.
Redox biology, 24, 101153-101153 (2019-03-26)
The early immature CD34+ acute myeloid leukemia (AML) cell subpopulation-acute myeloid leukemia progenitor cells (APCs), is often resistant to conventional chemotherapy, making them largely responsible for the relapse of AML. However, to date, the eradication of APCs remains a major
Bo Ra You et al.
Molecular carcinogenesis, 53(11), 847-857 (2013-05-11)
Zebularine (Zeb) is a DNA methyltransferase (DNMT) inhibitor to that has an anti-tumor effect. Here, we evaluated the anti-growth effect of Zeb on A549 lung cancer cells in relation to reactive oxygen species (ROS) levels. Zeb inhibited the growth of

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej