Skip to Content
Merck
All Photos(1)

Key Documents

EHU155731

Sigma-Aldrich

MISSION® esiRNA

targeting human CCR7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAGGTATGCCTGTGTCAAGATGAGGTCACGGACGATTACATCGGAGACAACACCACAGTGGACTACACTTTGTTCGAGTCTTTGTGCTCCAAGAAGGACGTGCGGAACTTTAAAGCCTGGTTCCTCCCTATCATGTACTCCATCATTTGTTTCGTGGGCCTACTGGGCAATGGGCTGGTCGTGTTGACCTATATCTATTTCAAGAGGCTCAAGACCATGACCGATACCTACCTGCTCAACCTGGCGGTGGCAGACATCCTCTTCCTCCTGACCCTTCCCTTCTGGGCCTACAGCGCGGCCAAGTCCTGGGTCTTCGGTGTCCACTTTTGCAAGCTCATCTTTGCCATCTACAAGATGAGCTTCTTCAGTGGCATGCTCCTACTTCTTTGCATCAGCATTGACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bing Xu et al.
Cancer medicine, 6(5), 1062-1071 (2017-04-06)
Chemokine and the chemokine receptor have a key role in the tumor progress. Here, we supposed that CCR7 might induce the invasion, migration, and epithelial-mesenchymal transition (EMT) process of breast cancer. In this research, human breast cancer MCF-7 and MDA-MB-231cells
Pelin Kaya et al.
Nutrients, 11(2) (2019-02-20)
Curcumae radix is the dry root of Curcuma longa L. (turmeric) that can be used either as a spice or traditional medicine. The aim of this study was to investigate the survival benefits and the anti-metastatic activity of curcumae radix
Lin-Hui Yuan et al.
International journal of ophthalmology, 10(6), 862-869 (2017-07-22)
To investigate the role of CCR7/p-ERK1/2/VEGF signaling in the mouse model of oxygen-induced retinopathy (OIR). Neonatal C57BL/6J mice were evenly randomized into four groups: normoxia, OIR, OIR control (treated with scramble siRNA), and OIR treated (treated with CCR7 siRNA). Normoxia
Fei Li et al.
Medical oncology (Northwood, London, England), 31(9), 180-180 (2014-08-22)
Secondary lymphoid tissue chemokine (SLC/CCL21) and its receptor CCR7 have been implicated in lymph node metastasis, whereas the mechanism of which remains unclear. Epithelial-mesenchymal transition (EMT) plays an important role in invasion and migration of cancer cells. We presumed that
George Malietzis et al.
Journal of surgical oncology, 112(1), 86-92 (2015-07-17)
The host local immune response (LIR) to cancer is a determinant of cancer outcome. Regulation of this local response is largely achieved through chemokine synthesis from the tumor microenvironment such as C-Chemokine-Receptor-7 (CCR7). We examined the LIR measured as CCR7

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service