Skip to Content
Merck
All Photos(1)

Documents

EHU093341

Sigma-Aldrich

MISSION® esiRNA

targeting human BBC3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAGCCAAACGTGACCACTAGCCTCCTGGAGCCAGAGAGTGGGGCTCGTTTGCCGGTTGCTCCAGCCCGGCGCCCAGCCATCTTCCCTGAGCCAGCCGGCGGGTGGTGGGCATGCCTGCCTCACCTTCATCAGGGGGTGGCCAGGAGGGGCCCAGACTGTGAATCCTGTGCTCTGCCCGTGACCGCCCCCCGCCCCATCAATCCCATTGCATAGGTTTAGAGAGAGCACGTGTGACCACTGGCATTCATTTGGGGGGTGGGAGATTTTGGCTGAAGCCGCCCCAGCCTTAGTCCCCAGGGCCAAGCGCTGGGGGGAAGACGGGGAGTCAGGGAGGGGGGGAAATCTCGGAAGAGGGAGGAGTCTGGGAGTGGGGAGGGATGGCCCAGCCTGTAAGATACTGTATATGCGCTGCTGTAGATACCG

Ensembl | human accession no.

ENSG00000105327

NCBI accession no.

NM_014417

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BBC3(27113) , BBC3(27113)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

S-G Xing et al.
European review for medical and pharmacological sciences, 22(13), 4341-4349 (2018-07-20)
Propofol is one of the most commonly used intravenous anesthetic agents used in cancer resections, but the effect of propofol on non-small cell lung cancer (NSCLC) remains unclear. Previous researches have reported that propofol can inhibit extracellular signal-regulated kinase (ERK)
Yu Li et al.
Cancer biomarkers : section A of Disease markers, 20(2), 175-181 (2017-09-05)
Studies in developing animals have demonstrated that when anesthetic agents, such as propofol, are early administered in life, it can lead to neuronal cell death and learning disabilities. However, the mechanisms causing these effects remains unknown. A recent report found that
Longwei Huo et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 347-355 (2017-05-30)
Glioma is the most common primary malignant tumor of the central nervous system. B10 is a new glycosylated derivative of betulinic acid with enhanced cytotoxic activity. The present study was designed to explore the molecular mechanism underlying the anticancer effect
Wenyi Liu et al.
Bioengineered, 11(1), 189-200 (2020-02-14)
MicroRNAs (miRNAs) have emerged as critical regulators of neuronal survival during cerebral ischemia/reperfusion injury. Accumulating evidence has shown that miR-211 plays a crucial role in regulating apoptosis and survival in various cell types. However, whether miR-211 is involved in regulating
Lin Wang et al.
Journal of Asian natural products research, 19(6), 630-643 (2017-04-26)
The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service