Skip to Content
Merck
All Photos(1)

Documents

EHU092281

Sigma-Aldrich

MISSION® esiRNA

targeting human VPS13A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCACTGAAGATCCAAGGGTATTTAAAGTAACATATGAAAGTGAGAAAGCAGAGTTAGCAGAGCAAGAAATTGCAGTGGCATTACAAGATGTTGGAATTTCTCTTGTCAACAATTACACGAAGCAAGAAGTAGCCTATATAGGCATTACAAGTTCTGATGTGGTTTGGGAAACAAAGCCCAAGAAGAAGGCAAGATGGAAGCCAATGAGTGTAAAGCACACTGAGAAGTTAGAGAGAGAATTTAAGGAATATACTGAATCTTCTCCTTCAGAAGATAAGGTTATTCAGTTGGACACTAATGTTCCGGTTCGCCTAACCCCTACTGGTCATAACATGAAAATTCTGCAGCCGCATGTAATAGCTCTACGAAGAAATTATCTTCCAGCATTAAAAGTGGAATATAACACATCTGCACATCAATCATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Willi Yu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(5), 1141-1152 (2016-12-14)
Chorein, a protein encoded by VPS13A (vacuolar protein sorting-associated protein 13A), is defective in chorea acanthocytosis, a rare disease characterized by acanthocytosis of red blood cells and neuronal cell death with progressive hyperkinetic movement disorder, cognitive dysfunction, behavioral abnormalities and
Sandra Muñoz-Braceras et al.
Disease models & mechanisms, 12(2) (2019-02-03)
Members of the VPS13 family are associated with various human diseases. In particular, the loss of function of VPS13A leads to chorea-acanthocytosis (ChAc), a rare neurodegenerative disease without available curative treatments. Autophagy has been considered a promising therapeutic target because
Sabina Honisch et al.
Oncotarget, 6(12), 10309-10319 (2015-04-15)
Chorein encoded by VPS13A (vacuolar protein sorting-associated protein 13A) is defective in chorea-acanthocytosis. Chorein fosters neuronal cell survival, cortical actin polymerization and cell stiffness. In view of its anti-apoptotic effect in neurons, we explored whether chorein is expressed in cancer

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service