Skip to Content
Merck
All Photos(1)

Key Documents

EHU081781

Sigma-Aldrich

MISSION® esiRNA

targeting human ST3GAL1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
PLN 1,060.00
50 μG
PLN 1,910.00

PLN 1,060.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
PLN 1,060.00
50 μG
PLN 1,910.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

PLN 1,060.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGTGGACCCTATGCTGGAGAAGAGGTCGGTGGGCTGCCGGCGCTGCGCCGTTGTGGGCAACTCGGGCAACCTGAGGGAGTCTTCTTATGGGCCTGAGATAGACAGTCACGACTTTGTCCTCAGGATGAACAAGGCGCCCACGGCAGGGTTTGAAGCTGATGTTGGGACCAAGACCACCCACCATCTGGTGTACCCTGAGAGCTTCCGGGAGCTGGGAGATAATGTCAGCATGATCCTGGTGCCCTTCAAGACCATCGACTTGGAGTGGGTGGTGAGCGCCATCACCACGGGCACCATTTCCCACACCTACATCCCGGTTCCTGCAAAGATCAGAGTGAAACAGGATAAGATCCTGATCTACCACCCAGCCTTCATCAAGTATGTCTTTGACAACTGGCTGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tan-Chi Fan et al.
Cancer letters, 434, 184-195 (2018-07-25)
GFRA1 and RET are overexpressed in estrogen receptor (ER)-positive breast cancers. Binding of GDNF to GFRA1 triggers RET signaling leading to ER phosphorylation and estrogen-independent transcriptional activation of ER-dependent genes. Both GFRA1 and RET are membrane proteins which are N-glycosylated
Wen-Der Lin et al.
Cancer immunology research, 9(1), 113-122 (2020-11-13)
Altered glycosylations, which are associated with expression and activities of glycosyltransferases, can dramatically affect the function of glycoproteins and modify the behavior of tumor cells. ST3GAL1 is a sialyltransferase that adds sialic acid to core 1 glycans, thereby terminating glycan

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service