Skip to Content
Merck
All Photos(1)

Documents

EHU070971

Sigma-Aldrich

MISSION® esiRNA

targeting human CUL1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATGCCCTGGTAATGTCTGCATTCAACAATGACGCTGGCTTTGTGGCTGCTCTTGATAAGGCTTGTGGTCGCTTCATAAACAACAACGCGGTTACCAAGATGGCCCAATCATCCAGTAAATCCCCTGAGTTGCTGGCTCGATACTGTGACTCCTTGTTGAAGAAAAGTTCCAAGAACCCAGAGGAGGCAGAACTAGAAGACACACTCAATCAAGTGATGGTTGTCTTCAAGTACATAGAAGACAAAGACGTATTTCAGAAGTTCTATGCGAAGATGCTCGCCAAGAGGCTCGTCCACCAGAACAGTGCAAGTGACGATGCCGAAGCCAGCATGATCTCCAAGTTAAAGCAAGCTTGCGGGTTCGAGTACACCTCTAAACTTCAGCGCATGTTTCAAGACATTGGCGTGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yue-Chao Fan et al.
Medical oncology (Northwood, London, England), 31(10), 227-227 (2014-09-10)
This study was designed to explore the role of Cullin1 (Cul1) in the pathogenesis of human glioma and to investigate the role of Cul1 in the growth, migration and invasion of glioma cells. Expression of Cul1 in 191 glioma tissues
Yan Zhou et al.
BMC cancer, 16(1), 818-818 (2016-10-23)
Triple-negative breast cancer (TNBC) has aggressive progression with poor prognosis and ineffective treatments. Selumetinib is an allosteric, ATP-noncompetitive inhibitor of MEK1/2, which has benn known as effective antineoplastic drugs for several malignant tumors. We hypothesized that Selumetinib might be potential
Ye-Fei Huang et al.
Cell death & disease, 10(1), 2-2 (2018-12-24)
CUL1 is an essential component of SCF (SKP1-CUL1-F-box protein) E3 ubiquitin ligase complex. Our previous study has showed that CUL1 is positively associated with poor overall and disease-specific survival of breast cancer patients. Here, we further explored its roles in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service