Skip to Content
Merck
All Photos(1)

Key Documents

EHU044111

Sigma-Aldrich

MISSION® esiRNA

targeting human MFN2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGATCAGGCGCCTCTCTGTACTGGTGGACGATTACCAGATGGACTTCCACCCTTCTCCAGTAGTCCTCAAGGTTTATAAGAATGAGCTGCACCGCCACATAGAGGAAGGACTGGGTCGAAACATGTCTGACCGCTGCTCCACGGCCATCACCAACTCCCTGCAGACCATGCAGCAGGACATGATAGATGGCTTGAAACCCCTCCTTCCTGTGTCTGTGCGGAGTCAGATAGACATGCTGGTCCCACGCCAGTGCTTCTCCCTCAACTATGACCTAAACTGTGACAAGCTGTGTGCTGACTTCCAGGAAGACATTGAGTTCCATTTCTCTCTCGGATGGACCATGCTGGTGAATAGGTTCCTGGGCCCCAAGAACAGCCGTCGGGCCTTGATGGGCTACAATGACCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yong Sun Lee et al.
Cancer letters, 433, 156-164 (2018-07-10)
Parkin, a critical gene of Parkinson's disease, is involved in the development of numerous cancers. However, the effect of parkin deficiency on melanoma growth and metastasis has not been reported. We showed that the tumor size and number of surface
Hongcai Cai et al.
Placenta, 70, 34-40 (2018-10-15)
Miscarriage is a common complication during pregnancy. Mitofusin-2 (MFN2) deficiency in trophoblastic cells is reported to be an important cause for early miscarriage. MFN2 can regulate mitochondrial autophagy, although the mechanisms remain unknown. This study aims to investigate the roles
Jihong Dong et al.
Journal of dairy science, 103(6), 5561-5574 (2020-04-13)
Inflammation is critical in the progression from benign hepatic lipidosis to pathological hepatic steatosis. The objective of this study was to examine the potential role of the outer mitochondrial membrane protein mitofusin 2 (MFN2) in the etiology of hepatic steatosis
Rui Zhang et al.
Molecular and cellular endocrinology, 452, 33-43 (2017-05-11)
This study was performed to investigate the oxidative stress-induced miRNA changes in relation to pathogenesis of diabetic retinopathy (DR) and to establish a functional link between miRNAs and oxidative stress-induced retinal endothelial cell injury. Our results demonstrated that oxidative stress
S Givvimani et al.
International journal of cardiology, 187, 325-333 (2015-04-05)
Mitochondria constitute 30% of cell volume and are engaged in two dynamic processes called fission and fusion, regulated by Drp-1 (dynamin related protein) and mitofusin 2 (Mfn2). Previously, we showed that Drp-1 inhibition attenuates cardiovascular dysfunction following pressure overload in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service